Symbimics

Keyword search

Medicago truncatula transcripts
Search based on gene names, annotation, TAIR or Swiss-Prot best hit, product keyword, GO term, Affymetrix probe, or genome release Mt3.5.1 and Mt4.0v1 accession [Full annotation table]
eg: IPR009810, nodulin, leghemoglobin, EFD, Medtr5g030920, Medtr4g134910, Mtr.36835.1.S1_at, GO:0009878


Sinorhizobium meliloti transcripts
Search based on gene names, synonyms, PubMed or Swiss-Prot best hit, GO term or product keyword [Full annotation table]
eg: FixJ, SMa1227



Blast search

Paste your sequences (FASTA formatted)
eg:
>test
tcaagatcccgattaccaattccagaatggtccaggcttatttgattccgatgaagaacg
cactcaaattccaacccaggttcaaactatggtcgaaggttcaggttccatcagggtatc
cgactacaaccctgctcctgatgttgattatctacaggagttattggctattcaacaaca
aggacctagagctattggcttttttggaacacggaacatgggattcatgcaccaggaact
aattgagattcttagctatgccatggttataactaaaaaccacatatacacatctggagc
atctgggaccaatgcagctgttattcggggtgctttaagagcagagaaacctgagttgct
tacagttatattaccccaaagtttaagcaaacagcctccagagagtcaggagctgttatc
caaggctatgtaatatggatatcatttcacacgtccagcaagtcatctgctttgctttcc
atgacagtaggttgctc
Run vs.

M. truncatula nicknames search

Query Nicknames system to get corresponding ids

Paste accessions
eg:
Mtr.40807.1.S1_at
TC139102
Mt16kOLI:43E19:MT015993