Symbimics

Blast search

Paste your sequences (FASTA formatted)
eg:
>test
tcaagatcccgattaccaattccagaatggtccaggcttatttgattccgatgaagaacg
cactcaaattccaacccaggttcaaactatggtcgaaggttcaggttccatcagggtatc
cgactacaaccctgctcctgatgttgattatctacaggagttattggctattcaacaaca
aggacctagagctattggcttttttggaacacggaacatgggattcatgcaccaggaact
aattgagattcttagctatgccatggttataactaaaaaccacatatacacatctggagc
atctgggaccaatgcagctgttattcggggtgctttaagagcagagaaacctgagttgct
tacagttatattaccccaaagtttaagcaaacagcctccagagagtcaggagctgttatc
caaggctatgtaatatggatatcatttcacacgtccagcaagtcatctgctttgctttcc
atgacagtaggttgctc
Run vs.