Ralstonia solanacearum str. GMI1000

  1. RS06047ISRso12-RS06047 ISRso12-

RS06047
RSp1333
RSp1333
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSp1334
RSp1334
ID ISRso12-
AC RS06047
LO RS06047
OR AL646053 from 1682997 to 1683884 on strand +
DE ISRso12-
CL
PM
AN
SQ 888 nt
 
........10........20........30........40........50
| | | | |
GCTCTAAGGCCGGCGCAGCGCAAAGCGCTCGTCGGCCATCTCATCGAACG
GTACCGCGTCAGCATTAAACGCGCCTGCCAGGTCTGCCGGCAAAGCCGCG
CAGGTTGGTACCAGAAGCCGAAACCGAGGCTGCTGGACGCACCGATCAAG
GCCCGCATGCACGAGATCGCCAGCACCCGGGTACGGTACGGCTTCTGGCG
CATTTACGTGCTGATTCGTCGCGAGGGTTGGTTGGTCAATCACAAACGCG
TCTACCGCCTGTACAAGGAGGAAGGCTTGAATCTGCGCACCAAAAGACCC
AGGCGCCGCAAGGCGGCCGCACATAGACTCGAGCGCCCGGTGCTCACCGC
ACCGAATCAGAGCTGGAGCATGGATTTCGTATCCGACGCCTTGTTTAACG
GCAACAAGTTCCGCGCACTGACTGTGGTGGACAACCATACGCGGGAATGC
CTGGCGATTGAGGCTGCCCCGTCGCTAAACGGCAGTGACGTTGTGCGTGT
GTTGCAAGCCATCGTGATCCGACGAGGCATGGTGCCCGCACGCATCCAGG
CTGACAACGGGCCGGAATTTGTGTCGCTGGCGCTGGACAAGTGGGCGTAT
GAGGCAGGCGTAACGCTCGACTTCTCTCGGCCTGGCAAGCCTACCGACAA
TGCCTTCATCGAGTCCTTCAACGGCAGCTTGCGCGATGAATGCCTGAACA
CGTACTGGTTCCTGTCCCTTGAAGACGCACGCCAAAAGCTCGAAAACTGG
AGGCACGATTACAATCATTTCCGGCCACATTCGGCGCTGGATGACACCGC
ACCAGCGCTCTTTGCACGGCAGTTTGCCATTACACCAACCACGCCGGCTT
CTCTAGCCTGACCCTGTCCAGTTCTTGGGAGGAGGTCA
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one tY8wtHbI)