Ralstonia solanacearum str. GMI1000

  1. RS06001IS1421RS06001 IS1421

RS06001
RSc1670
RSc1670
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence

ID IS1421
AC RS06001
LO RS06001
OR AL646052 from 1792206 to 1793068 on strand -
DE IS1421
CL
PM
AN
SQ 863 nt
 
........10........20........30........40........50
| | | | |
TGCCGCTAACAAAACCAAGTCATCGAACGCAGGTGGTTGAGCGTTGTTGT
TGGCATGGCACGAAAGAAGATCAGCAATGAACTGTGGAAGGCATTGCAAC
CGCTGCTGCCGGTTGTGGAGCCTTCGACCAAAGGCGGTCGTCCGCGCGTG
GATGATCGGGCGGCGCTCAACGGCATCCTGTTTGTTCTGCATACCGGTAT
CCCGTGGGAAGACCTGCCTAAAGAACTGGGCTTTGGCAGCGGCATGACGT
GCTGGCGTCGCCTGCGGGAGTGGCAGGCCAACGGCGTTTGGGAGCGGCTG
CATTTGGCTCTGCTCAAGCGCCTACGCGAACACGACCAGATCGACTGGAG
CCGAGCCAGTGTCGACGGTGCAACGGTGGCCAGCCCCCGGGGGGCGAGCA
GACGGGGCCGAATCCAACGGATCGCGGCAAGCTCGGTAGCAAGCGCCATC
TCGTCGTAGATCGGCGCGGCGTGCCGTTGGCGCTGATGGTCACCGGTGCC
AATCGTCACGACTCGGTGGTGTTCGAGGTGCTCGTTGACGCCATCCCGAG
CGTGCCCGGACTCGATGGCCGCCCGCGATGCCGCCCCGACAAGCTTCACG
CGGATAAGGGATACGACTTCGCGCGATGCCGCCGGCATCTGCGCAAGCGG
GGCATGACTCCCCGGATCGCTCGCCGTGGCATCGAGAAGAACGACCGGCT
CGGCAAGCATCGCTGGGTGGTCGAACGCACCCATGCCTGGCTTGCTGGAT
TCGGCAAGTTGCGCATTCGTTTCGAGCGTTCTCTTCAGACTCACCTCGCT
TTGCTCACCCTGGCTTGCGCCGTCATCTGCGGACGATTTGTTGATCGGTT
TTGTTAGCGACTC
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one 32wpXH92)