Ralstonia solanacearum str. GMI1000

  1. RS05964ISRso16-RS05964 ISRso16-

RS05964

Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSp1624
RSp1624
ID ISRso16-
AC RS05964
LO RS05964
OR AL646053 from 2046824 to 2047499 on strand +
DE ISRso16-
CL
PM
AN
SQ 676 nt
 
........10........20........30........40........50
| | | | |
TGACCCTACACCAGGAAACAGTACCGCAGAGCAGTAGGGAATCCGGCATG
ATTTTCACGAATTGAAAAGGAAGACATGCCATGAAGACGAGCAAGTTCAC
CGAAGCGCAGATAGCGTTCGCACTGAAGCAAGCGGAGCTGGGCACGAAGG
TCGAGGAGGTGTGCCGCAAGCAGGGGATCAGCGAATTCGGAGCTACGCCG
GATGCGGCAACTCGAGGAAGAGAAAGCGACTCGTCGGCATTGCTTGCACG
CATCAAAGAGATTGCGGCCACTACGGCTATCACCGTGTGCACGTGATGCA
GCAGCGGGAGAGCTGGAAAGACAATCACAAACGCGTCTATCACCTGTATC
GAGCGGAAGGCTTGTCGCTGCGGCATAAACGCCCCAAGTGCAACAAGTCG
GCGCGGCTACGCCAGCCCAAGAGCATTGTCATGGGCATCAACGAAATCTG
GAGCATGGACTTTGTATCCGACGCGTTGCTCGACGGCCAGCGCTTGCGCG
CGTTGACCGTGGTGGACAACTACACCAGGGAAAGCCTGGCCATCGAAGTC
GGCCAAAGCCTGAAGGGGAAAGACGTTGTGCGAGTGCTCGATGCCGTTGT
TGCCCAGCATGGCACGCCTCAAACCATCAAGGTGGACAATGGCACCGAGT
TCATCTCGAAGGCGATGGACCGATCG
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one E26Psx6x)