Ralstonia solanacearum str. GMI1000

  1. RS05962ISRso10RS05962 ISRso10

RS05962
RSp0565
RSp0565
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSp0566
RSp0566
ID ISRso10
AC RS05962
LO RS05962
OR AL646053 from 707871 to 709206 on strand +
DE ISRso10
CL
PM
AN
SQ 1336 nt
 
........10........20........30........40........50
| | | | |
TGGAGCGGCCCCCTGAATCGCCGGACACCGTCACCCACTTAAACAAACGG
GTAGGCATACAACTGTGTTCATGACTAGCGGCAAGCAAGAAGTGATGGAA
GTGTTGACGGGCCCGGAGCGCCGCCGGCGGTGGTCGGTGGAAGAGAAGCT
TGCGCTGGTCAGGGAGAGCTTCGAGCCGGGCAAGACGGTCTCGATGGTGG
CGCGCCAGCACGGCGTGAATCCGAATCAGGTGTTCCACTGGCGCAAGCTG
TACCAGGACGGGAGCCTGTCGGCGGTGAGTGCGGGCGAGGAAGTGGTGCC
GGCTTCGGAGTTGGCCGAGGCGCTCAAGCTAGTCCGTGTGCTGCAGCGCA
TGCTCGGCAAGAAGACGATGGAGAACGAGATTCTTCGCGAAGCCGTGGAA
TACGGTCGGGCAAAAAAGTGGATTGCGCGCTCGCCATCGCTGCCGGGGGA
CGACCAGTGAAGCAGGTTTGCGAGGTCCTCGGCGTAGCGCGTTCAAACGT
GGCGGCCATGCGTACTCGACCTGCTGACTGGCGCGACGGGCGAACAGCTC
GGCAAACCGACGACGCTGGCCTGATGGACGAAATCCGGCACGTCATTGCC
GGCTTGCCGAGCTATGGCTACCGGCGTGTCTGGGGCCGATTGTGGCGCGA
ACGCGCGAGTCGATGCGAAGCACTCATCAATGCCAAGCGGGTCTATCAGG
TCATGCGCGGGCACGGTCTGCTGCTTGAGCGCAGGCCGACGCCACCGCGC
CCACGGCGCTGGCATGACGGCAAGGTCGCCGCGGCCAAGAGCAACCAGCG
CTGGTGCTCCGATGGCTTCGAGTTCCGCTGCGACAACGGTGAGCCGCTGC
GCGTGACGTTCGCATTGGACTGCTGTGACCGCGAGGCGATGAGCTGGGTA
GCAACGACGGGTGGCTACAGCGGCGACGTCGTGTGCGACGTGATGCTGGC
GGCTGTCGAGCAGCGCTTCGGCAATGTTCCGAAAGCACCGGCGGAGATTG
AATGGCTGACCGACAACGGCTCAGGCTACATTGCTGGGAAGACGCGCGAG
TTCGCCACGGATATTGGCCTGAAGCCGTTGACGACGCCGGTTTGCAGCCC
GCAGAGTAACGGCATGGCAGAGAGCTTCGTGAAGACGATGAAGCGCGACT
ACGTGGCCTTCATGCCCAAACCGGATGCGGCGACGGCTGCGCGCAACCTT
GCCATCGCATTCGAGCACTACAACGAGCAGCATCCCCATAGCGCACTGAA
ATATCGTTCGCCACGCGAGTTCAGGCGCAGGACGGAATCATCAATTCAAG
TGTGAGACGGTGTCCGGAGATACGGGGGCAAATCCA
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one MlxAEfMA)