Ralstonia solanacearum str. GMI1000

  1. RS05961ISRso10-RS05961 ISRso10-

RS05961
RSc2335
RSc2335
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSc2336
RSc2336
ID ISRso10-
AC RS05961
LO RS05961
OR AL646052 from 2533637 to 2533838 on strand -
DE ISRso10-
CL
PM
AN
SQ 202 nt
 
........10........20........30........40........50
| | | | |
TGGAACGGCCCCCAGAATCCCCGGACACAGTCACCCACTTAAACTACGGG
TAGGCATACGACTGTGTTTATGACTAGCAGCAACCAAGAAGTGATGGAAG
TGTTGACGGGCCCGGAGCGTCGCCGGCGGTGGTCGGTGGAAGAGAAGCTT
GCGATGGTCCGAGAGAGCTTTGAGCCGGGCAAGACGGTCTCGATGGTGGC
GC
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one O4zye2TQ)