Ralstonia solanacearum str. GMI1000

  1. RS05959ISRso8RS05959 ISRso8

RS05959
RSp0546
RSp0546
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSp0547
RSp0547
ID ISRso8
AC RS05959
LO RS05959
OR AL646053 from 687737 to 689023 on strand +
DE ISRso8
CL
PM
AN
SQ 1287 nt
 
........10........20........30........40........50
| | | | |
TGAGCTTCCCTCGAAATTTCGCCTTCCAGCAGGTCGCACGTAAACTCGAC
CCCAAGGAAGGCAAGAAATGTTCAAGGTACCGAAACAGTCATACACGGCG
GAGTTCAAGGCGGCAGCCGTACAACGAGTCAAAGACGGGCAAGGCGTGGG
TGCGGTGGCCCGCGAGTTGAGCGTCTCGGAGCAGACGCTGCGCAACTGGA
TGAAGGCCGAGCAGGCTGGCAAGCTGGGCGGCGCCGGCGCGAAGGTCGTC
ACGCCGGAGCAGATGGAGCTCTCGCGCCTGCGCGCCGAGAACAAGCGGCT
GCAAATGGAACTCGAAATCGCAAAAAAGGCGGCGGCGTACTTCGCGAAAG
ACCTGCTGTGAAGTACGCCTGGATTGACCAGCAGTGTCGGCACTATCCGC
TGTCGGCGCTGTGCGGGGTCCTCTCGGTCAGCGTCAACGGCTATCGTGCC
TGGAGGCGAGGCGGCACGCCCGAGCGCAAGCGGCTCACCGACACGCAATT
GCTCACATTGATTCGGGCCATCCATGCGCAGTTCAAGGGCGCCTATGGCT
CGCCGCGCATGACCGAAGAGATTCGCGCACGCGGGTTCCCGGCCAGCAAA
GCGCGCGTGGAACGCCTGATGAGCCAGAACGGCATCCGGGCACGCCACAA
GCGCCGTTATCGGGTCACGACCGATTCCAGGCACAAGCTGCCGGTCGCGC
CGAACCTGCTGAACCGCGAGTTCACGCCGGCCGAGCCGAATCAGGTGTTC
AGTTCGGACATCACATACATCTGGACCGACGAGGGCTGGCTGTATCTGGC
CGTGGTGCTGGACCTGTTCAATCGGGAAGTCATGGGTTGGTCCATCAAGC
CGCGCATGACGGCAGACCTGGTGACCGACGCACTGACGATGGCGTGGTTC
CGCCGCAAGCCCGCGCCCGGCGCGCTGCATCATTCGGACCGTGGCAGCCA
GTACGCGAGCCACGAATTCCAGCGCAAGCTGGCCGAATACGGCATGCGCT
GTTCGATGAGCCGCAAGGGAAATTGTTGGGACAACGCACCGACTGAGAGC
TTCTTCAACAGCCTGAAGAACGAACGGGTGCATGCCACGCGCTACCGGAC
GCATCAGGAGGCTGCGGCGGACCTGTTCGAATACATCGAAGTGTTTTATA
ACCGCAGTCGCCGTCATTCGTCGCTCGGCTTTGTCTCGCCAGCTCAGTTC
ATGCAGGACTGGCTCAAGGCTCAACAGGTGAAGGAAACGGCTGCATAACC
CAGGGCCTCTGGAAGGCGAAAAACAGAGGGAAGGTCA
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one 999zUtdQ)