Ralstonia solanacearum str. GMI1000

  1. RS05958ISRso5-RS05958 ISRso5-

RS05958
RSp0453
RSp0453
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSp0454
RSp0454
ID ISRso5-
AC RS05958
LO RS05958
OR AL646053 from 564894 to 565530 on strand -
DE ISRso5-
CL
PM
AN
SQ 637 nt
 
........10........20........30........40........50
| | | | |
CTAGTGTCCTGTTCCGTTGTTAACTGGTCTAAGTTTACATAGGATGTTGG
CATCAACGAAACGGGAGATGCCAGCATGCCAATGGGACGGCCGAAGGCGG
AACTGGTGCTGAGCGAGGACGAGCAGACGCAACTGGCTGGGATGGTGCGT
TCGCGCAGTATCCCGGCGGCGTTGGTGATGCGTGCGCGCCTTGTCTTGGC
GGCGGCCGCAGGCGAGCCCAACAGTGAGATCGCCGAGCGCCTGCAGCTCA
CGCGCGCTACGGTGGGCAAATGGCGCGCCCGGTTCCTTGAGCGGCGCATC
AATGGGTTGTACGACGAACTGCGACCCGGCAAGCCGCGTACCATCGACGA
CGAGCGCGTGGCCGAACTCATCAAGACGACGCTGCATACGAAGCCTGCGG
ATGGCTCGACTCACTGGAGTGTGCGCGCGGTGGCGGCCGAGACATCGATC
TCGCCTACCAGCGTGCACCGCTATTTCAAGCTGTTGGGGCTGCAACCGCA
TCGCAGCGAGACCTTCAAGCTGTCCACCGATGCGTTTTTCATCGAGAAGC
TGCGCGACGTGGTGGGGCTGTATCTGAACCCGCCCGAGAATGCATTGGTG
CTGTGCGTGGACGAGAAGAGCCAGTGCCAGGCACTGG
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one 5BLT6Yhb)