Ralstonia solanacearum str. GMI1000

  1. RS05957IS1421RS05957 IS1421

RS05957
RSp0040
RSp0040
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSp0041
RSp0041
ID IS1421
AC RS05957
LO RS05957
OR AL646053 from 45837 to 46700 on strand +
DE IS1421
CL
PM
AN
SQ 864 nt
 
........10........20........30........40........50
| | | | |
GTGCCGCTAACAAAACCAAGTCATCGAACGCAGGTGGTTGAGCGTTGTTG
TTGGCATGGCACGAAAGAAGATCAGCAATGAACTGTGGAAGGCATTGCAA
CCGCTGCTGCCGGTTGTGGAGCCTTCGACCAAAGGCGGTCGTCCGCGCGT
GGATGATCGGGCGGCGCTCAACGGCATCCTGTTTGTTCTGCATACCGGTA
TCCCGTGGGAAGACCTGCCGAAAGAACTGGGCTTTGGCAGCGGCATGACG
TGCTGGCGTCGCCTGCGGGAGTGGCAGGCCAACGGCGTTTGGGAGCGGCT
GCATTTGGCTCTGCTCAAGCGCCTACGCGAACACGACCAGATCGACTGGA
GCCGAGCCAGTGTCGACGGTGCAACGGTGGCCAGCCCCCGGGGGGCGAGC
AGACGGGGCCGAATCCAACGGATCGCGGCAAGCTCGGTAGCAAGCGCCAT
CTCGTCGTAGATCGGCGCGGCGTGCCGTTGGCGCTGATGGTCACCGGTGC
CAATCGTCACGACTCGGTGGTGTTCGAGGTGCTCGTTGACGCCATCCCGA
GCGTGCCCGGACTCGATGGCCGCCCGCGATGCCGCCCCGACAAGCTTCAC
GCGGATAAGGGATACGACTTCGCGCGATGCCGCCGGCATCTGCGCAAGCG
GGGCATGACTCCCCGGATCGCTCGCCGTGGCATCGAGAAGAACGACCGGC
TCGGCAAGCATCGCTGGGTGGTCGAACGCACCCATGCCTGGCTTGCTGGA
TTCGGCAAGTTGCGCATTCGTTTCGAGCGTTCTCTTCAGACTCACCTCGC
TTTGCTCACCCTGGCTTGCGCCGTCATCTGCGGACGATTTGTTGATCGGT
TTTGTTAGCGACTC
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one 0NokJ3u7)