Ralstonia solanacearum str. GMI1000

  1. RS05953ISRso1-RS05953 ISRso1-

RS05953

Cluster
DrawMap
XML file

FASTA file
Extract
Sequence

ID ISRso1-
AC RS05953
LO RS05953
OR AL646052 from 3472141 to 3472388 on strand +
DE ISRso1-
CL
PM
AN
SQ 248 nt
 
........10........20........30........40........50
| | | | |
GAGCCCGTTTGAAAATTCCCCGCGAGGGTGATGTAAAGGCGGGATGTGGA
AAAAAGAACATCGAGAACGCGAGGCGAAGCTGGCTCGCAAGACCAAGCGT
TACCCCAGCGATATGACGGACGTCGAATGGGCCGCTGTGCAGCCGCTGCT
GCCACGCGTAGCCGTGCGAGGTCGGCGCCGGGAGTGCGACTTGCGGGAGG
TCGCCAATGCCCTGCGCTATCTGGTGCGGGCGGGTTGCGGTTGGCGCA
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one 4CDJpWK7)