Ralstonia solanacearum str. GMI1000

  1. RS05951ISRso1-RS05951 ISRso1-

RS05951
RSc1494
RSc1494
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSc1495
RSc1495
ID ISRso1-
AC RS05951
LO RS05951
OR AL646052 from 1598900 to 1598983 on strand +
DE ISRso1-
CL
PM
AN
SQ 84 nt
 
........10........20........30........40........50
| | | | |
CCAGCTTCGCCTCGCGTTCTCGATGTTCTTTTTTTCGACATCCCGCCTTT
ACATCACCCTTGCAGGGAATTTTCAAACGGGCGC
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one ttk1Wnhr)