Ralstonia solanacearum str. GMI1000

  1. RS05950ISRso1RS05950 ISRso1

RS05950
RSc3198
RSc3198
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSc3199
RSc3199
ID ISRso1
AC RS05950
LO RS05950
OR AL646052 from 3460579 to 3461462 on strand +
DE ISRso1
CL
PM
AN
SQ 884 nt
 
........10........20........30........40........50
| | | | |
GAGCCCGTTTGAAAATTCCCCGCGGTTGTGATGTAAATGCGGGATGTGGA
AAAAAGAAGATCGAGAGCGTGAGGCGAAGCTGGCTCGGAAGACCAAGCGT
TACCCGAGCGACCTGACGGATATCGAATGGGCCGCTGTGCAGCCGCTGCT
GCCACGCGCGGCCGTGCGAGGCCGGCGTCGGGAGTGCGACTTGAGGGAGG
TGGTCAACGCCTTGCGCTATCTGGTGCGAGCGGGCTGCGGTTGGCGCATG
CTGCCGCACGACTTCCCGCCTTGGCAAACCGTGTATTGGTGGTTTCGTCG
GCTCATGCGCCGCTTGCTGTTCCGCACGCTGCACGACGTGGTGCTGATGT
TGGACCGGGAGTTGGCTGGGCGGCAGCCGTGCCCAAGTGCGGGCGTCATC
GACAGCCAGACAGTCAAAGCGCCCTCGGCCGACAAGCGTGGCTATGACGC
GGCCAAGAAAATCGTCGGGAGCAAGCGGCATATCGCGGTGGACACGGATG
GACGGCTGCTGATGGTGAACCTGACACCGACGGACATTGCCGATAGCACG
GGTGCGCTGGCGGTGCTGGAAGCGGTGAAGAAGCGCTGGCCAGGCATAAA
ACACCTGTTCGCTGACGGTGCGTATGACCGCACAGCGCTGATGGACAAGG
CATCGACCCTCGACTTCGTGGTTGAGGTGGTGCGCCGGCACGAGCAGCAA
ACGGGCTTGGCCGTTCTGCCGCGCCGCTGGGTGGTCGAGCGCACCTTTGG
GTGGATGGTTCGCTGGCGCCGACTCGTACGCGACTACGAACAGCGGGCAG
ACGTATCGGAAGCCATGATTCATATCGCGATGAGTGGCTTGTTACTGCGC
AGAATCGCTCATCCTTGAATTTCCAAACGGGCTC
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one Glywb7U4)