Ralstonia solanacearum str. GMI1000

  1. RS05949ISRso17-RS05949 ISRso17-

RS05949
RSp0154
RSp0154
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence

ID ISRso17-
AC RS05949
LO RS05949
OR AL646053 from 178940 to 179047 on strand +
DE ISRso17-
CL
PM
AN
SQ 108 nt
 
........10........20........30........40........50
| | | | |
TCTTACTGTGTCATAAAAAGTAGCGCATTATATGTACTTCCTAATTCAAG
GTGGGGAGTGCATGAGCGCAAGCGACCGATTTGCGGAGTACATGAACTAC
TTGGTCGA
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one E3VOeIny)