Ralstonia solanacearum str. GMI1000

  1. RS05948ISRso17-RS05948 ISRso17-

RS05948

Cluster
DrawMap
XML file

FASTA file
Extract
Sequence

ID ISRso17-
AC RS05948
LO RS05948
OR AL646053 from 180524 to 181899 on strand +
DE ISRso17-
CL
PM
AN
SQ 1376 nt
 
........10........20........30........40........50
| | | | |
ACTACTTGGCTGAGGGATTGGGGCATGCAGATCGCCGGGCCGGCTTGGAG
AGCTATTGCACTGGCCTGATGCTGCCGCTGTCGCGCAAGAGCGTCGAACC
GATGGCGGCACGGGTTGACCCGTTGCATGCCAGTGCTCGGCATCAGTCAC
TGCACCACTTCGTCTCCAAATCCGATTGGTCGGATACGGCGTTGTTAAGC
CGTGTCCGGGACTGGGTTCAGCCCTTGCTGGAAGCGCCAAGCGGTCGCTA
TTGGATCATTGACGACACGGGTTTCCCTAAGAAAGGCAAACATTCGGTTG
GCGTGGCACGCCAATATTGCGGCCAGCTTGGCAAACAGGACAACTGCCAG
GTGGCAGTCAGCCTGTCGCTGGCCACAGAGCAAGGCAGCCTTCCGATTGC
CTATCAGCTTTATCTCCCCAAGGAATGGGCCGACGATGCGACTCGCCGCC
AGAAGGCCGGCGTGCCTGACGATATCGTGTTCGCCACCAAGCCGGAGATT
GCCCTGGCGCAAGTGCGCGAGGCGATCGCAGCCGGGGTGCCAGCCGGAGT
CGTGCTGGCCGACGCTGCATATGGCGATGAAACCGGGTTTCGCGAAAATC
TGACCGAGTTGGGTCTGCTTTACGCCGTCGGGATTCGCTCCACGACGACG
GTGTGGCCGCCGGGCGTTTCGCCACTGCCGGCCAAACCGGCGAGCGGTCC
GGGTAGGCCACCGAAGTTGTTGCGTCGCGCACCGGGCCATGAGCCGGTTT
CAGTGAAGACCCTGGCGATGGCATTACCCTCGAGCGCTTACCAAGTGGTG
ACTTGGCGGGAAGGCATCAATACAGCCCTTTCATCGCGATTTGCGGCCGT
GCGGGTTCGCCCGGCGCATCGGGACTATTGGCGCAGCACCTTGCGCGACG
AAGAATGGTTGCTGGTTGAGTGGCCGGGGGGCGAAGCGGAGCCAACCAAA
TACTTCTTGTCCACAGCACCAGCCGATGCGCTGATAGAACAACTGGTGTT
CGTGACCAAAATGCGTTGGCGTATTGAGCGCGATTACCAGGACTTGAAAC
AAGAGCTCGGCCTTGGTCACTACGAAGGCCGGGGCTGGCGCGGATTCCAC
CATCATGCGACGCTGAGTATCGCAGCCTATGGCTTCCTGATGGCCGAACG
ACTCGCTGCAGACAAGCCCGTGGGGAATAAAAAAAACTTCCTCGAATGCC
AGATACCTGCGCTTCCCGCGGATTACATCCCCCGTGGCAGCCCTGCGTGC
GCAGCGACACGTGACGAATTCAATCCCCACACTCCGTCATCAACTTAGCT
ACCACCTGATGCGCAGCCTTGGGCTTTGCCCATGCTGCGCGTCGGGCTGA
TCAATCACATTTGTGACACAGTAAGA
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one wSwHwc3J)