Ralstonia solanacearum str. GMI1000

  1. RS05940ISRso12-RS05940 ISRso12-

RS05940
RSp1298
RSp1298
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSp1299
RSp1299
ID ISRso12-
AC RS05940
LO RS05940
OR AL646053 from 1648630 to 1648974 on strand +
DE ISRso12-
CL
PM
AN
SQ 345 nt
 
........10........20........30........40........50
| | | | |
TGACCTCCCCCCGAAATATTGGACACGCCAGAACTGGAGAAAACCGGCGA
CACTGCCCTTGAAGGAGGGAGTTCGCCATGAAGAAGTCGAAGTTCACGGA
AGAGCAGATTGCGTTCGCGCTGCATCAGGCCGAGACAGGTGTCTCGGTCG
AAGAGGTATGCCGCAAGATTGGCATCTCGCAAGCGACGTTTTACGCGTGG
AAGAAGAAGTACGGCGGTATTGGCGTGAGCGAGCTACGGCGGTTGCGTCA
ACTTGAAGAGGAGAACGCCAAGCTGCGGCGCTTGGTGGCCGACTTGAGCC
TGGACAAGGTCATGCTGCAGGATGTTCTGAGAAAAAAGCTCTAAG
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one IredNAnC)