Ralstonia solanacearum str. GMI1000

  1. RS05939ISRso12-RS05939 ISRso12-

RS05939
RSp1303
RSp1303
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSp1304
RSp1304
ID ISRso12-
AC RS05939
LO RS05939
OR AL646053 from 1652801 to 1653694 on strand +
DE ISRso12-
CL
PM
AN
SQ 894 nt
 
........10........20........30........40........50
| | | | |
AAACGGGCTCTAAGGCCGGCGCAGCGCAAAGCGCTCGTCGGCCATCTCAT
CGAACGGTACCGCGTCAGCATTAAACGCGCCTGCCAGGTCTGCCGGCAAA
GCCGCGCAGGTTGGTACCAGAAGCCGAAACCGAGGCTGCTGGACGCACCG
ATCAAGGCCCGCATGCACGAGATCGCCAGCACCCGGGTACGGTACGGCTT
CTGGCGCATTTACGTGCTGATTCGTCGCGAGGGTTGGTTGGTCAATCACA
AACGCGTCTACCGCCTGTACAAGGAGGAAGGCTTGAATCTGCGCACCAAA
AGACCCAGGCGCCGCAAGGCGGCCGCACATAGACTCGAGCGCCCGGTGCT
CACCGCACCGAATCAGAGCTGGAGCATGGATTTCGTATCCGACGCCTTGT
TTAACGGCAACAAGTTCCGCGCACTGACTGTGGTGGACAACCATACGCGG
GAATGCCTGGCGATTGAGGCTGCCCCGTCGCTAAACGGCAGTGACGTTGT
GCGTGTGTTGCAAGCCATCGTGATCCGACGAGGCATGGTGCCCGCACGCA
TCCAGGCTGACAACGGGCCGGAATTTGTGTCGCTGGCGCTGGACAAGTGG
GCGTATGAGGCAGGCGTAACGCTCGACTTCTCTCGGCCTGGCAAGCCTAC
CGACAATGCCTTCATCGAGTCCTTCAACGGCAGCTTGCGCGATGAATGCC
TGAACACGTACTGGTTCCTGTCCCTTGAAGACGCACGCCAAAAGCTCGAA
AACTGGAGGCACGATTACAATCATTTCCGGCCACATTCGGCGCTGGATGA
CACCGCACCAGCGCTCTTTGCACGGCAGTTTGCCATTACACCAACCACGC
CGGCTTCTCTAGCCTGACCCTGTCCAGTTCTTGGGAGGAGGTCA
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one lDE5JfeD)