Ralstonia solanacearum str. GMI1000

  1. RS05938ISRso11-RS05938 ISRso11-

RS05938
RSc2264
RSc2264
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSc2265
RSc2265
ID ISRso11-
AC RS05938
LO RS05938
OR AL646052 from 2456643 to 2458033 on strand -
DE ISRso11-
CL
PM
AN
SQ 1391 nt
 
........10........20........30........40........50
| | | | |
AGTATGAAGAGGCGTTCAAGCGCCAAGTAGTTCAGGAGTATTTGAGGGGG
GCCGTTGGGACCGCAGGGCTGAGCCAGAAGTACGGGATAGGCCGTTCTGT
GATCCGGCGCTGGATCAACGCGTGGCAGCGCCATGGGAAATCCGGACTAC
GCAAGAAGCATGAAGCGTATAGCGCCGAGTTCAAGCTGACGGTGCTGCAG
CGCATGTGGCGCGACGAGTTGTCCTATCAGCAAGTCAGCGCTGTGTTCGA
TTTGCGTGAGGCTGGCGGCGTCAGCCGCTGGGACCGCCAGTATCATGAGG
GCGGTTTCGACGCCCTACAGCCGCGCCGCAAAGGCGGGGCACCCATCATG
TCCCAGTCCAAGCAAGATCCCCAACCCGCTGCGCAGCCGGCTCAAGACGA
GCGCTCGCGCGAGGATTTGCTCAAAGAGAACGAGTGTTTGCGCGCGGAGG
TGGCGTACCTAAAAAAGTTAGATGCCCTGCTGCGTGCCAAACAGCAGCAG
GCACCAAAGAAAAAGCGCAAGTCGTGAGTGCGCTGCGTGAGCGGCATTCA
TTGTCGAGCTTGCTCAAGGCCGCGAATCTCGCACGCAGCACGTACTACTA
CCAGATGGCGACAGGCCAGGCAGAGGATCGTCACGGCGCGCTCAAGGAGC
GCATTCAGCACATCTATGCCCAGCACAAGGGCCGATATGGCTACCGCCGG
ATCACGGCGACGCTCCGTCGGGCAGGGACGTTGGTGAATCACAAGACCGT
ACAGCGATTGATGTCGGCGCTACAGTTGAAGTCACTCGTGCGGCCGAAGA
AATACCGCTCTTACCTCGGGCAAGTCGGGCGGGTTGCTCCCAATCTGCTA
CAGCGCGAGTTTGAGGCGAGCAAGCCGAACGAGAAGTGGGTAACGGACGT
GACGGAGTTCAACGTCGGCGGCAAAAAGCTGTACCTGTCGCCCGTCCTGG
ACCTATACAACGGAGAGATCGTCGCCTGGCAAACCAGTGAACGACCTGAT
TACACGCTGATCCGGGAGATGCTCGACAAGGCGTTGCGCAAGCTGCGCCC
GTGCGAGACGCCGATGCTGCATTCGGATCAAGGCTGGCCGTATCAAATGG
CAGCGTATCGTCGCAAACTGGCCGCGCGAGGCCTGCGCCAGAGCATGTCC
CGCAAAGGCAACTGCCTAGACAATGCGGCAATGGAAAGCTTCTTCGGCAC
ACTCAAGTCAGAGTGCTTCCGGTTAGAGCGCTTCGCGGACATCGACCAAC
TGCGACGCGCCATTGCCGAATACATCCGGTACTACAATCACGAGCGCATC
AAGATCAAGCTAAAAGGGCTGAGCCCTGTGCAATACAGGACCCAGCCCTT
GGCCGCCTAAATTACCCGTCCAACTTTACGGGGTCAGTTCA
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one RuoAh6Oo)