Ralstonia solanacearum str. GMI1000

  1. RS05937ISRso10RS05937 ISRso10

RS05937
RSc2330
RSc2330
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSc2331
RSc2331
ID ISRso10
AC RS05937
LO RS05937
OR AL646052 from 2530436 to 2531572 on strand -
DE ISRso10
CL
PM
AN
SQ 1137 nt
 
........10........20........30........40........50
| | | | |
GCGCGCCAGCACGGCGTGAATCCGAATCAGGTGTTCCAGTGGCGCAAGCT
GTACCAAGACGGGAGCCTGTCGGCAGTGACCGCGGGCGAGGAAGTGGTGC
CGGCCTCGGAGCTGGCCGAAGCGCTCAAACAAGTCCGTGAGCTGCAGCGC
ATGCTCGGCAAGAAGACGATGGAGAACGAGATTCTTCGCGAAGCCGTGGA
ATACGGTCGGGCAAAAAAGTGGATAGCGCGCTCGCCATCGTTGCCGGGGG
ACGACCAGTGAAGCTAGTTTGCGAGGTCCTCGGCGTAGCGCGCTCAAACG
TGGCGGCCAAGCGGGCCCGGCCGGGTGATTGGCGCGACGGGCGCACAGCT
CGGCAAACCGACGACGCTAGCTTGGTCGACGAAATCCGGCGCACCATCGC
CGACTTGCCGAGCTATGGCTACCGGCGGGTCTGGGGCAGATTGCGGCGCG
AACGTGAGCGTCAATGCGAAGCGCCGATCAATGCCAAGCGTGTCTATCGG
GTCATGCGTGTGCACAGCTTGCTGCTTGAGCGCAGGCCGACGCCACCGCG
TCCACCGCGCCGGCATGACGGCAAGGTCGCCGTGGCCAAGAGCAACCAGC
GCTGGTGCTCCGATGGCTTCGAGTTCCGCTGCGACAACGGCGAGCCGCTG
CGGGTGACGTTCGCGCTGGATTGCTGCGACCGCGAGGCGATGAGCTGGGT
GGCGACGACCGGCGGCTACAGCGGCGACGTAGTACGCGACGTGATGCTGG
CGGCCGTCGAGCAGCGCTTCGGCAATGTTCCGAAAGCGCCAGCGGAAATT
GAATGGCTGACGGACAACGGCTCAGGCTACATTGCTGGGAAGACTCGCGA
GTTCGCCACGGACATTGGCTTGAAGCCATTGACGACACCGGTTTGCAGCC
CGCAGAGCAACGGCATGGCCGAGAGCTTCGTGAAGACGATGAAGCGCGAC
TACGTCGCCTTCATGCCCAAGCCTGACGCGGCCACAGCGACGCGCAACCT
CGCCATCGCGTTCGAGCATTACAACGAGCAGCATCCCCATAGCGCACTGA
AATATCGCTCGCCACGCGAGTTCAGGCGCAGGACGGAATCATCAACTCAA
GTGTGAGGCGGTGTCCGGAGATGCGGGGGCAAATCCA
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one tCJhQgy6)