Ralstonia solanacearum str. GMI1000

  1. RS05935IS1021RS05935 IS1021

RS05935
RSp0205
RSp0205
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSp0206
RSp0206
ID IS1021
AC RS05935
LO RS05935
OR AL646053 from 254516 to 255723 on strand -
DE IS1021
CL
PM
AN
SQ 1208 nt
 
........10........20........30........40........50
| | | | |
GGAAACGCTGATTTATCAGGCTCGGCGGTCATCGCTGACGTAGCCGAGGA
CGTTGCGGAAGGAAGCTCACGGAGTGGACCGACGACGATGAAGAAGCAAA
CCAGCTTTTCGGAAGCGGAGTACGCGGGCAAGAAACGCGTGACCAAGCGT
GAGCGTTTCCTGGCGGAGATGGAGAAGGTCGTTCCATGGACGCGGCTGGT
TGCGGCAGTCGAGCCGCACTACCCCAAAGGAGAACGAGGACGGCCGCCAA
TCGGGCTGCAGAGGATGCTGCGCATTTATTTCTTGCAGCAGTGGTACGGG
CTGTCGGACGAAGGACTGGAAGATGCGTTGTACGACAGCATGGCGATGCG
TGCGTTCGCCGGCATTGATCTGGCGGTCGAGAACGTGCCGGACGCGACCA
CGCTGCTGAAGTTCCGGCGCCTGCTGGTCGAGCATGACCTGACTGGCAAG
CTGTTCGACGAGATCGGCATCATGCTGTGCGAGCGGGGGCTGATGATGAG
GGAAGGCACGATCGTGGATGCCACCATCATCGAAGCGCCGCCGTCGACCA
AGAATGCCGAGAAGAGCCGCGATCCGGAGATGCACCAGACCAAGAAGGGC
AACGAATGGCACTTTGGAATGAAGGCACACATTGGGGTGGATGCGTCGTC
GGGCCTGGTGCATAGCGTGGTTGGCACGGCAGCGAATGAGTCCGATGTCT
CGCAGGCCCACGCGTTGCTGCATGGCCATGAGGAAGACGCGTTTGGCGAT
GCAGGTTACACCGGCGTTGAGAAGCGCGACGAGATGCAAGGCAAGGGCAC
GAAGTGGCATGTTGCGCTCAAGCGCAGCAAGATCAAGGCGATGCGCGATG
GCGCCATCAAGGACTTGCTAATCGCGGCGGAGAGGACCAAGGCTCAGATT
CGGGCTCGGGTCGAACATCCGTTCCATGTCATCAAGAATCTGTTTGGTCA
TCGCAAGGTTCGTTACAAGGGCTTGGCCAAGAACACGGCGCAACTGTTCA
GCTTGTTCGGTCTCGCCAATCTGGTGCTCGCCAGGAGCCAGTTGCTGGCC
AGCCCTGAAAGCATTCCGTCCTGAGCGCGCAAAGCGCGCCAGGCACCACG
CGAAAACGGCGGAAAACGTGCTCAATCGGCACTTCCTTCCCGCGATGCGG
AAACCTTGAACAGGATGGCTCGCGATTCCATTCACGGACCCCATTGATCA
GCGTTTCC
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one co6uXVoY)