Ralstonia solanacearum str. GMI1000

  1. RS05934ISRso1RS05934 ISRso1

RS05934
RSc3350
RSc3350
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSc3351
RSc3351
ID ISRso1
AC RS05934
LO RS05934
OR AL646052 from 3612024 to 3612907 on strand -
DE ISRso1
CL
PM
AN
SQ 884 nt
 
........10........20........30........40........50
| | | | |
GAGCCCGTTTGAAAATTCCCCGCCGTTGTGGTGTAAAGGCGGGATGTGGA
AAAAAGAACATCGAGAACGCGAGGCGAAGCTGGGTCGCAAGACCAAGCGG
TACCCAAGCGACCTGACGGATATCGAATGGGTCGCTGTGCAGCCGTTGCT
GCCCCGCGCCGCCGTGCGAGGTCGGCGTCGGGAGTGCGACTTGAGGGAGG
TGGTCAACGCCTTGCGCTATCTTGTGCGAGCGGGCTGCGGTTGGCGCATG
CTGCCTCACGACTTCCCGCCTTGGCAAACCGTGTATTGGTGGTTTCGTCG
GCTCATGCGTCGCTTCCTGTTCCGCACGCTGCACGACGTGGTGCTGATGT
TGGACCGGGAGTTGGCTGGGCGGCAGCCGTGCCCAAGTGCGGGCGTCATC
GACAGCCAGACAGTCAAAGCGCCCTCGGCCGACAAGCGTGGCTACGACGC
GGCCAAGAAAATCGTCGGGCGCAAGCGGCATATCGCGGTGGACACGGATG
GACGGCTGCTGATGGTGAACCTGACACCGGCGGACATTGCTGATAGCACG
GGTGCGCTGGCGGTGCTGGAAGCGGTGAAGAAGCGCTGGCCAGGCATAAA
ACACCTGTTCGCTGACGGTGCGTATGACCGCACAGCGCTGATGGACAAGG
CATCGACCCTCGACTTCGTGGTTGAGGTGGTGCGCCGGCACGAGCAGCAA
ACGGGCTTTGCCGTTCTGCCGCGCCGCTGGGTGGTCGAGCGCACCTTTGG
ATGGATGGTTCGCTGGCGTCGACTCGTACGCGACTACGAACAGCGGGCAG
ACGTATCGGAAGCCATGATTCATATCGCGATGAGCGGCTTGCTACTGCGC
AGAATCGCTCATCCTTGAATTTCCAAACGGGCTC
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one te6Rkfen)