Ralstonia solanacearum str. GMI1000

  1. RS05932ISRso18RS05932 ISRso18

RS05932
RSc1703
RSc1703
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSc1704
RSc1704
ID ISRso18
AC RS05932
LO RS05932
OR AL646052 from 1820117 to 1821304 on strand -
DE ISRso18
CL
PM
AN
SQ 1188 nt
 
........10........20........30........40........50
| | | | |
GGATGATGTTCAAAACTCCCGCAAACCCGGACAGTCAAAGGAAGGTTCGC
GAAACGGGATGAGTCCATGAAACAAACCGACCTTGGCCTGGACCTGAGCA
ACCGGCGCACGCGCAAGCAGGTATTTCTCGACGAGATGGAGCGCGTGGTG
CCATGGCAGGCGTTTTTGGCGCTGATAGCACCGCATGCGCCGACCAAGGC
GACCGGCCGCAAGCCGTTTCCAATCGAGGCGATGCTGCGCATCCACTTGT
TGCAGCAATGGTTCGGGCTGTCGGACGTGGCGATGGAAGAGGCGCTGTAC
GACGTGCCGTTGTATCGTCAATTCGCGGGTCTGGGTGGCATGAGCCGGCT
GCCGGACCGGGTCAGCATTCTGCGCTTCCGGCACTTGCTGGAGCGGCACA
AGCTGGCCGAGCAGTTTCTGCAGACCGTCAACGAGCAACTCAGTGCCAAG
GGGTACCTGCTCAAAGAGGGCACGGCGGTCGATGCCACGCTGATTTCCGC
GCCCAGCTCGACGAAGAACCAAAGCGGCGAGCGCGACCCTGAGATGCACC
AGACCAAGAAAGGCAACCAGTGGCATTTCGGCATGAAGGCGCACATCGGT
GTGGATGCAGACTCGGGGCTGGTGCATACCGTGGTGGGCACGGCGGCCAA
CGTCAACGATGTTACGCAAGCGCATGCTCTGGTGCATGGCAAGGAGGCCG
ATGTGTTCGGCGATGCCGGCTACCAGGGCATCGACAAGCGCGAGGAAGTG
CAGAAGCTGAAGGTGCGTTGGCATGTGGCATTGCGCCCGGGCAAGCGCCG
CGCCTTGGACAAGAACACCGCGCTGGGCAAGCTCGTTGATGAACTGGAAC
GGGTCAAGGCGCGCATCCGTGCCCGCGCGGAACATCCGTTTCGTGTCATC
AAGCGCCAGTTCGGGCATCTGAAGGTTCGCTATCGCGGCTTGATGAAGAA
CACGCAACAGTTGCACACGCTGTTCGCCCTGAGCAACCTGTGGATGATGC
GCGGGCGACTGATGGGTGAGGCCCGCGCATGAGTGCGCCGGCCATTGGCC
AAGCTGCCCAGGAGCCAGAAACCGGCCCGCCTTCAGGCTGAACACGACGC
TGTATTCGAGCTCGCCATCACATCGTTTGCACTGCGTCGGCTCTGCATCG
ATGACTCGGTGCGACGGAGTGAGTTCTGAACACCATCC
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one gFhBLtYK)