Ralstonia solanacearum str. GMI1000

  1. RS05931ISRso17RS05931 ISRso17

RS05931
RSp0125
RSp0125
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSp0126
RSp0126
ID ISRso17
AC RS05931
LO RS05931
OR AL646053 from 145864 to 147334 on strand +
DE ISRso17
CL
PM
AN
SQ 1471 nt
 
........10........20........30........40........50
| | | | |
TCTTACTGTGTCATAAAAAGTAGCGCATTATATGTACTTCCTAATTCAAG
GTGGGGAGTGCATGAGCGCAAGCGACCGATTTGCGGAGTACATGAACTAC
TTGGCTGAGGGATTGGGGCATGCAGATCGCCGGGCCGGCTTGGAGAGCTA
TTGCACTGGCCTGATGCTGCCGCTGTCGCGCAAGAGCGTCGAACCGATGG
CGGCACGGGTTGACCCGTTGCATGCCAGTGCTCGGCATCAGTCACTGCAC
CACTTCGTCTCCAAATCCGATTGGTCGGATACGGCGTTGTTAAGCCGTGT
CCGGGACTGGGTTCAGCCCTTGCTGGAAGCGCCAAGCGGTCGCTATTGGA
TCATTGACGACACGGGTTTCCCTAAGAAAGGCAAACATTCGGTTGGCGTG
GCACGCCAATATTGCGGCCAGCTTGGCAAACAGGACAACTGCCAGGTGGC
AGTCAGCCTGTCGCTGGCCACAGAGCAAGGCAGCCTTCCGATTGCCTATC
AGCTTTATCTCCCCAAGGAATGGGCCGACGATGCGACTCGCCGCCAGAAG
GCCGGCGTGCCTGACGATATCGTGTTCGCCACCAAGCCGGAGATTGCCCT
GGCGCAAGTGCGCGAGGCGATCGCAGCCGGGGTGCCAGCCGGAGTCGTGC
TGGCCGACGCTGCATATGGCGATGAAACCGGGTTTCGCGAAAATCTGACC
GAGTTGGGTCTGCTTTACGCCGTCGGGATTCGCTCCACGACGACGGTGTG
GCCGCCGGGCGTTTCGCCACTGCCGGCCAAACCGGCGAGCGGTCCGGGTA
GGCCACCGAAGTTGTTGCGTCGCGCACCGGGCCATGAGCCGGTTTCAGTG
AAGACCCTGGCGATGGCATTACCCTCGAGCGCTTACCAAGTGGTGACTTG
GCGGGAAGGCATCAATACAGCCCTTTCATCGCGATTTGCGGCCGTGCGGG
TTCGCCCGGCGCATCGGGACTATTGGCGCAGCACCTTGCGCGACGAAGAA
TGGTTGCTGGTTGAGTGGCCGGGGGGCGAAGCGGAGCCAACCAAATACTT
CTTGTCCACAGCACCAGCCGATGCGCTGATAGAACAACTGGTGTTCGTGA
CCAAAATGCGTTGGCGTATTGAGCGCGATTACCAGGACTTGAAACAAGAG
CTCGGCCTTGGTCACTACGAAGGCCGGGGCTGGCGCGGATTCCACCATCA
TGCGACGCTGAGTATCGCAGCCTATGGCTTCCTGATGGCCGAACGACTCG
CTGCAGACAAGCCCGTGGGGAATAAAAAAAACTTCCTCGAATGCCAGATA
CCTGCGCTTCCCGCGGATTACATCCCCCGTGGCAGCCCTGCGTGCGCAGC
GACACGTGACGAATTCAATCCCCACACTCCGTCATCAACTTAGCTACCAC
CTGATGCGCAGCCTTGGGCTTTGCCCATGCTGCGCGTCGGGCTGATCAAT
CACATTTGTGACACAGTAAGA
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one xh3utRDy)