Ralstonia solanacearum str. GMI1000

  1. RS05928ISRso17RS05928 ISRso17

RS05928
RSp0474
RSp0474
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSp0475
RSp0475
ID ISRso17
AC RS05928
LO RS05928
OR AL646053 from 589849 to 591319 on strand -
DE ISRso17
CL
PM
AN
SQ 1471 nt
 
........10........20........30........40........50
| | | | |
TCTTACTGTGTCATAAAAAGTAGCGCATTATATGTACTTCCTAATTCAAG
GTGGGGAGTGCATGAGCGCAAGCGACCGATTTGCGGAGTACATGAACTAC
TTGGCTGAGGGATTGGGGCATGCAGATCGCCGGGCCGGCTTGGAGAGCTA
TTGCACTGGCCTGATGCTGCCGCTGTCGCGCAAGAGCGTCGAACCGATGG
CGGCACGGGTTGACCCGTTGCATGCCAGTGCTCGGCATCAGTCACTGCAC
CACTTCGTCTCCAAATCCGATTGGTCGGATACGGCGTTGTTAAGCCGTGT
CCGGGACTGGGTTCAGCCCTTGCTGGAAGCGCCAAGCGGTCGCTATTGGA
TCATTGACGACACGGGTTTCCCTAAGAAAGGCAAACATTCGGTTGGCGTG
GCACGCCAATATTGCGGCCAGCTTGGCAAACAGGACAACTGCCAGGTGGC
AGTCAGCCTGTCGCTGGCCACAGAGCAAGGCAGCCTTCCGATTGCCTATC
AGCTTTATCTCCCCAAGGAATGGGCCGACGATGCGACTCGCCGCCAGAAG
GCCGGCGTGCCTGACGATATCGTGTTCGCCACCAAGCCGGAGATTGCCCT
GGCGCAAGTGCGCGAGGCGATCGCAGCCGGGGTGCCAGCCGGAGTCGTGC
TGGCCGACGCTGCATATGGCGATGAAACCGGGTTTCGCGAAAATCTGACC
GAGTTGGGTCTGCTTTACGCCGTCGGGATTCGCTCCACGACGACGGTGTG
GCCGCCGGGCGTTTCGCCACTGCCGGCCAAACCGGCGAGCGGTCCGGGTA
GGCCACCGAAGTTGTTGCGTCGCGCACCGGGCCATGAGCCGGTTTCAGTG
AAGACCCTGGCGATGGCATTACCCTCGAGCGCTTACCAAGTGGTGACTTG
GCGGGAAGGCATCAATACAGCCCTTTCATCGCGATTTGCGGCCGTGCGGG
TTCGCCCGGCGCATCGGGACTATTGGCGCAGCACCTTGCGCGACGAAGAA
TGGTTGCTGGTTGAGTGGCCGGGGGGCGAAGCGGAGCCAACCAAATACTT
CTTGTCCACAGCACCAGCCGATGCGCTGATAGAACAACTGGTGTTCGTGA
CCAAAATGCGTTGGCGTATTGAGCGCGATTACCAGGACTTGAAACAAGAG
CTCGGCCTTGGTCACTACGAAGGCCGGGGCTGGCGCGGATTCCACCATCA
TGCGACGCTGAGTATCGCAGCCTATGGCTTCCTGATGGCCGAACGACTCG
CTGCAGACAAGCCCGTGGGGAATAAAAAAAACTTCCTCGAATGCCAGATA
CCTGCGCTTCCCGCGGATTACATCCCCCGTGGCAGCCCTGCGTGCGCAGC
GACACGTGACGAATTCAATCCCCACACTCCGTCATCAACTTAGCTACCAC
CTGATGCGCAGCCTTGGGCTTTGCCCATGCTGCGCGTCGGGCTGATCAAT
CACATTTGTGACACAGTAAGA
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one LJHxQZGk)