Ralstonia solanacearum str. GMI1000

  1. RS05926ISRso17RS05926 ISRso17

RS05926
RSp1330
RSp1330
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSp1331
RSp1331
ID ISRso17
AC RS05926
LO RS05926
OR AL646053 from 1680642 to 1682112 on strand -
DE ISRso17
CL
PM
AN
SQ 1471 nt
 
........10........20........30........40........50
| | | | |
TCTTACTGTGTCATAAAAAGTAGCGCATTATATGTACTTCCTAATTCAAG
GTGGGGAGTGCATGAGCGCAAGCGACCGATTTGCGGAGTACATGAACTAC
TTGGCTGAGGGATTGGGGCATGCAGATCGCCGGGCCGGCTTGGAGAGCTA
TTGCACTGGCCTGATGCTGCCGCTGTCGCGCAAGAGCGTCGAACCGATGG
CGGCACGGGTTGACCCGTTGCATGCCAGTGCTCGGCATCAGTCACTGCAC
CACTTCGTCTCCAAATCCGATTGGTCGGATACGGCGTTGTTAAGCCGTGT
CCGGGACTGGGTTCAGCCCTTGCTGGAAGCGCCAAGCGGTCGCTATTGGA
TCATTGACGACACGGGTTTCCCTAAGAAAGGCAAACATTCGGTTGGCGTG
GCACGCCAATATTGCGGCCAGCTTGGCAAACAGGACAACTGCCAGGTGGC
AGTCAGCCTGTCGCTGGCCACAGAGCAAGGCAGCCTTCCGATTGCCTATC
AGCTTTATCTCCCCAAGGAATGGGCCGACGATGCGACTCGCCGCCAGAAG
GCCGGCGTGCCTGACGATATCGTGTTCGCCACCAAGCCGGAGATTGCCCT
GGCGCAAGTGCGCGAGGCGATCGCAGCCGGGGTGCCAGCCGGAGTCGTGC
TGGCCGACGCTGCATATGGCGATGAAACCGGGTTTCGCGAAAATCTGACC
GAGTTGGGTCTGCTTTACGCCGTCGGGATTCGCTCCACGACGACGGTGTG
GCCGCCGGGCGTTTCGCCACTGCCGGCCAAACCGGCGAGCGGTCCGGGTA
GGCCACCGAAGTTGTTGCGTCGCGCACCGGGCCATGAGCCGGTTTCAGTG
AAGACCCTGGCGATGGCATTACCCTCGAGCGCTTACCAAGTGGTGACTTG
GCGGGAAGGCATCAATACAGCCCTTTCATCGCGATTTGCGGCCGTGCGGG
TTCGCCCGGCGCATCGGGACTATTGGCGCAGCACCTTGCGCGACGAAGAA
TGGTTGCTGGTTGAGTGGCCGGGGGGCGAAGCGGAGCCAACCAAATACTT
CTTGTCCACAGCACCAGCCGATGCGCTGATAGAACAACTGGTGTTCGTGA
CCAAAATGCGTTGGCGTATTGAGCGCGATTACCAGGACTTGAAACAAGAG
CTCGGCCTTGGTCACTACGAAGGCCGGGGCTGGCGCGGATTCCACCATCA
TGCGACGCTGAGTATCGCAGCCTATGGCTTCCTGATGGCCGAACGACTCG
CTGCAGACAAGCCCGTGGGGAATAAAAAAAACTTCCTCGAATGCCAGATA
CCTGCGCTTCCCGCGGATTACATCCCCCGTGGCAGCCCTGCGTGCGCAGC
GACACGTGACGAATTCAATCCCCACACTCCGTCATCAACTTAGCTACCAC
CTGATGCGCAGCCTTGGGCTTTGCCCATGCTGCGCGTCGGGCTGATCAAT
CACATTTGTGACACAGTAAGA
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one In6OYDdn)