Ralstonia solanacearum str. GMI1000

  1. RS05925ISRso16-RS05925 ISRso16-

RS05925
RSp1627
RSp1627
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSp1628
RSp1628
ID ISRso16-
AC RS05925
LO RS05925
OR AL646053 from 2048571 to 2049556 on strand -
DE ISRso16-
CL
PM
AN
SQ 986 nt
 
........10........20........30........40........50
| | | | |
TGACCCTACACCAGGAAACAGTACCGCAGAGCAGTAGGGAATCCGGCATG
ATTTTCACGAATTGAAAAGGAAGACATGCCATGAAGACGAGCAAGTTCAC
CGAAGCGCAGATAGCGTTCGCACTGAAGCAAGCGGAGCTGGGCACGAAGG
TCGAGGAGGTGTGCCGCAAGCAGGGGATCAGCGAATTCGGAGCTACGCCG
GATGCGGCAACTCGAGGAAGAGAAAGCGACTCGTCGGCATTGCTTGCACG
CATCAAAGAGATTGCGGCCACTACGGCTATCACCGTGTGCACGTGATGCA
GCAGCGGGAGAGCTGGAAAGACAATCACAAACGCGTCTATCACCTGTATC
GAGCGGAAGGCTTGTCGCTGCGGCATAAACGCCCCAAGTGCAACAAGTCG
GCGCGGCTACGCCAGCCCAAGAGCATTGTCATGGGCATCAACGAAATCTG
GAGCATGGACTTTGTATCCGACGCGTTGCTCGACGGCCAGCGCTTGCGCG
CGTTGACCGTGGTGGACAACTACACCAGGGAAAGCCTGGCCATCGAAGTC
GGCCAAAGCCTGAAGGGGAAAGACGTTGTGCGAGTGCTCGATGCCGTTGT
TGCCCAGCATGGCACGCCTCAAACCATCAAGGTGGACAATGGCACCGAGT
TCATCTCGAAGGCGATGGACCGATGGGCATACGAGCACGGCGTCGAGCTC
GACTTTAGTCGGCCAGGCACGCCCACCGACAATGCCAAGGTGGAAAGCTT
CAACGGGCGGTTCCGGCAGGAATGCCTGAATGAGCACTGGTTTTTGTCCC
TGGAGGATGCTCAGAGCAAAATCGCCGACTGGCGGCGGCACTATAACGAA
AGTCGCCCCCACTCTGCATTGCAGTGGGCGACACCCGACGAATTCGCCCG
TCAGGCAAGGAAGAGCGCCTCGATGGACGATTCAACGACGCCGGAAATCT
CTACTTCTGGGCGTTACTAATTCCGGTGTAGGGCCA
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one FasWU9Vs)