Ralstonia solanacearum str. GMI1000

  1. RS05924ISRso16RS05924 ISRso16

RS05924
RSp0556
RSp0556
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSp0557
RSp0557
ID ISRso16
AC RS05924
LO RS05924
OR AL646053 from 699344 to 700581 on strand +
DE ISRso16
CL
PM
AN
SQ 1238 nt
 
........10........20........30........40........50
| | | | |
TGACCCTACACCAGGAAACAGTACCGCAGAGAAGTAGAGAATCCGGCATG
ATTTTCACGAATTGAAAAGGAAGACATGCCATGAAGACGAGCAAGTTCAC
CGAGGCGCAGATAGCGTTCGCATTGAAGCAGGCGGAGCTAGGTACGAAGG
TTGAGGAGGTGTGCCGCAAGCTGGGCATCAGCGAAGCGACGTTCTACAAC
TGGAAGAAGAAGTACGGGGGCGTCGGCCCTTCGGAGCTGCGCCGGATGCG
GCAACTCGAGGAAGAGAACACGAAGCTCAAGCGGCTGGTGGCGGATCTGA
GCCTGGACAAGGCCATGCTGCAGGACGTGTTGTCAAAAAAGCTCTGAAGC
CTTCCCGCAAGCGCACGCTGGTTGACGAATTGCGCGACCGCTACCGTGTG
AGCCTGACCAAGGCTTGCGCGTTGTTTCACATGTCGCGCTCGCTGTACGG
GTATCGCTCGGTTGCTCGCGACTCGTCGGCACTGCTTGCGCGCATCAAAG
AGATTGCGGCCAGTCGCGTGCATTACGGCTATCGCCGTGTGCATGTGATG
CTGCAGCGGGAAGGCTGGAGAGACAATCACAAACGCGTCTATCGCTTGTA
CCGGGCCGAAGGTCTGTCGCTGCGGCATAAGCGCCCCAAGCGCAACAAGT
CGGCGCGGCTACGCCAGCCCAAGAGCATCGTCACGGCCATCAACGAAATC
TGGAGCATGGACTTTGTATCCGACGCGTTATTCGACGGCCGGCGCCTGCG
CGCATTGACGGTCGTGGACAACTACACCAGGGAATGCCTGGCCATCGAAG
TCGGCCAAAGCCTGAAGGGGGAAGACGTCGTGCGAGTGCTCAATGCCGTT
GTTGCCCAGCGTGGCTCACCCCAAACCATCAAGGTGGACAATGGCAGCGA
GTTTGTCTCGAAGGCGATGTACCGGTGGGCGTACGAGCACGGCGTGGAAC
TCGACTTCAGTCGGCCAGGCACGCCTCCTGACAATGCCAAGGTGGAAAGC
TTCAACGGGCGGTTCCGGCAGGAATGCCTGAACGAGCACTGGTTCTTGTC
CCTGGAGGATGCTCGGGGCAAAATCGCCGACTGGCAGCGGTACTATAACG
AGAGTCGTCCCCACTCCGCGCTGCAGTGGGCGGCACCCGCCGAATTCGCC
CATCAGGCAACGAAAAACGCCTCGACGGACGACTCAACGACGCCGGAAAT
CTCCACTTCTGGACGGTACTAATTCCGGTGTAGGGTCA
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one C58Q58Kf)