Ralstonia solanacearum str. GMI1000

  1. RS05923ISRso15RS05923 ISRso15

RS05923
RSp1546
RSp1546
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSp1547
RSp1547
ID ISRso15
AC RS05923
LO RS05923
OR AL646053 from 1947869 to 1949172 on strand -
DE ISRso15
CL
PM
AN
SQ 1304 nt
 
........10........20........30........40........50
| | | | |
GGTTCTTCGAAGAATTCCGTGAGCCTGAACTGGCACATTCCGTATGCTGA
CGCCGACAAGGACAGGTGTTAGGAGGTGGGATGCTGGATCGCAAGACACT
GCAAGCGCTGGGCTGCTGGAAGGGTTACCGCCTGGAGCGCGTGGAGTGGC
CGCAAGGCGAGAGCCGCACGCTATCGCTCTATCTGAAGCCAGTCAGCAAG
GTCATGCACTGTGAGCAATGCGGAACGCGTTGCTCGCAGATTCATGAGAC
GACAGCTCGGCGGGTACGTGATCTGCCGCTCTTCGAGTACCGGGTGGTGC
TGCACGTCCCACGCCGGCGCGTGTGGTGCGAGCGTTGTGGCGGACCTCGG
CTGGAGAAGCTGGACTGGCTGGGCCGCTACCAGAGAGTGACGCAGCGATT
CGCCGAGGCCTGCGAGAAGCTGCTGCAGTCGAGCAGCGTACAGGCGGTGG
CCGCGTTCTACGATCTGGGCTGGCACACGGTCAAATCGATCGACAAGATG
CGCTTGCGAGCGCGTGTGGTCGAACCGGACTGGTCGACGATCCGTTATCT
GGCGATGGACGAGTTCGCACTCCATAAAGGCCATCGCTATGCCACGGTGG
TCGTTGATCCGATCGGCCGGCAGGTGCTCTGGATCGGGCCGGGGCGCTCG
CGCGAGACTGCCCGCGCCTTCTTCGAACAGCTTCCGGAGGGCGTTGCCCA
GCGCATCGAGGCGGTGGCAATCGACATGACGACCGCCTACGAACTGGAGA
TCAACGCGCATTGCCCGCAGGCCGAGGTGGTCTACGACTTGTTCCACGTC
GTGGCCAAGTATGGGCGTGAGGTGATCGACCGGGTGCGGGTGGATCAGGC
CAATCAACTCCGGCATGACAAGCCGGCCCGGAAGGTTCTGAAGTCCAGCC
GGTGGCTGTTGCTACGCAAGCGCCACAATCTGAAGCCAGAGCAGGCCGTG
CACCTGAAGGAGCTGCTGGCCGCCAATCAGTCGCTGTTATGCGTCTACGT
GCTGCGCGACGAGTTGAAACGGCTCTGGTTTTACCGCAGACCGGCCTGGG
CGCAAAAGGCCTGGGAACAATGGTTTGAGCAGGCTCGGCAAAGCGGGATC
GCCGCTTTGCAACTGTTCGCCCAGCGCCTGGAGGGCTACTGGCATGGAAT
TCTGGCCCGCTGCCGCCACCCGCTCAACACCAGCGTCGTCGAAGGCATCA
ACAACACCATCAAGGTCATCAAACGTCGGGCTTACGGGTACCGCGACGAG
GAATACTTCTTCCTCAAGATCCGCGCCGCGTTCCCCGGAATTCCTCGATG
AACC
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one XEdVupKN)