Ralstonia solanacearum str. GMI1000

  1. RS05922ISRso15RS05922 ISRso15

RS05922
RSc2572
RSc2572
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSc2573
RSc2573
ID ISRso15
AC RS05922
LO RS05922
OR AL646052 from 2780073 to 2781376 on strand +
DE ISRso15
CL
PM
AN
SQ 1304 nt
 
........10........20........30........40........50
| | | | |
GGTTCTTCGAAGAATTCCGTGAGCCTGAACTGGCACATTCCGTATGCTGA
CGCCGACAAGGACAGGTGTTAGGAGGTGGGATGCTGGATCGCAAGACACT
GCAAGCGCTGGGCTGCTGGAAGGGTTACCGCCTGGAGCGCGTGGAGTGGC
CGCAAGGCGAGAGCCGCACGCTATCGCTCTATCTGAAGCCAGTCAGCAAG
GTCATGCACTGTGAGCAATGCGGAACGCGTTGCTCGCAGATTCATGAGAC
GACAGCTCGGCGGGTACGTGATCTGCCGCTCTTCGAGTACCGGGTGGTGC
TGCACGTCCCACGCCGGCGCGTGTGGTGCGAGCGTTGTGGCGGACCTCGG
CTGGAGAAGCTGGACTGGCTGGGCCGCTACCAGAGAGTGACGCAGCGATT
CGCCGAGGCCTGCGAGAAGCTGCTGCAGTCGAGCAGCGTACAGGCGGTGG
CCGCGTTCTACGATCTGGGCTGGCACACGGTCAAATCGATCGACAAGATG
CGCTTGCGAGCGCGTGTGGTCGAACCGGACTGGTCGACGATCCGTTATCT
GGCGATGGACGAGTTCGCACTCCATAAAGGCCATCGCTATGCCACGGTGG
TCGTTGATCCGATCGGCCGGCAGGTGCTCTGGATCGGGCCGGGGCGCTCG
CGCGAGACTGCCCGCGCCTTCTTCGAACAGCTTCCGGAGGGCGTTGCCCA
GCGCATCGAGGCGGTGGCAATCGACATGACGACCGCCTACGAACTGGAGA
TCAACGCGCATTGCCCGCAGGCCGAGGTGGTCTACGACTTGTTCCACGTC
GTGGCCAAGTATGGGCGTGAGGTGATCGACCGGGTGCGGGTGGATCAGGC
CAATCAACTCCGGCATGACAAGCCGGCCCGGAAGGTTCTGAAGTCCAGCC
GGTGGCTGTTGCTACGCAAGCGCCACAATCTGAAGCCAGAGCAGGCCGTG
CACCTGAAGGAGCTGCTGGCCGCCAATCAGTCGCTGTTATGCGTCTACGT
GCTGCGCGACGAGTTGAAACGGCTCTGGTTTTACCGCAGACCGGCCTGGG
CGCAAAAGGCCTGGGAACAATGGTTTGAGCAGGCTCGGCAAAGCGGGATC
GCCGCTTTGCAACTGTTCGCCCAGCGCCTGGAGGGCTACTGGCATGGAAT
TCTGGCCCGCTGCCGCCACCCGCTCAACACCAGCGTCGTCGAAGGCATCA
ACAACACCATCAAGGTCATCAAACGTCGGGCTTACGGGTACCGCGACGAG
GAATACTTCTTCCTCAAGATCCGCGCCGCGTTCCCCGGAATTCCTCGATG
AACC
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one HVmAFBh1)