Ralstonia solanacearum str. GMI1000

  1. RS05921ISRso14RS05921 ISRso14

RS05921
RSc1491
RSc1491
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSc1492
RSc1492
ID ISRso14
AC RS05921
LO RS05921
OR AL646052 from 1596962 to 1598195 on strand -
DE ISRso14
CL
PM
AN
SQ 1234 nt
 
........10........20........30........40........50
| | | | |
TGACCTGCCCCCAATAAACCGGTCCACCGGGAAGCTAGTAGAGTCCGTTT
TCGGAGAGGAAGACGGACATGAAGAAGCGGTTTACGGAAGCGCAAATCAT
CGGGTTCCTGAAGGAGGCCGAGGCCGGCGTGGCGGTCAAGGAGCTGTGCA
GGAAGCACGGATTCAGTGACGCATCGTTCTACACCTGGCGGGCCAAGTTC
GGCGGGATGGAGGTGTCGGAGGCCCGGCGGCTCAAGGAGCTGGAAGCCGA
GAACGCCAAGCTGAAGAAGCTGCTGGCCGAAGCGATGCTGGACATGGAAG
CGCTGAAGGTGGTGGTCAAGGGAAAGCCCTGAGCCCGCAAGCCAAGCGCG
AGGCGGTCGTGGCGATTCGGCGGAAGGTCAGCATCTCCGAGCGTCGCGCC
TGCCGGCTTGTCGGGCTGTCCCGCAGCGTGCTGCATTACGAAGCGCAAAC
TGCGCCAGGAAACGAGATACTCAAAGCGCGGCTGGTTGAGCTGGCGCATG
AGCGTCGGCGCTTTGGTTACCGGCGACTGCACGTTCTGCTGGAGCGCGAG
GGTCTGCACGCGAATCACAAACGCGTACACCGGTTATATCGCGAGGCTGG
CTTGGCTGTGCGGCGTCGGCGGCGACGCCACGGCGTGATGGTCGAGCGCG
AGCGACTGGCTCTGCCGGCCGCGCCGAACGAGGTCTGGTCGATAGACTTC
GTGATGGACGCGTTGTCCAATGGGCGTCGCCTGAAGTGCCTGACCATCGT
TGATGACTTCACGAAAGAAGCGGTCGACATCGTCGTAGACCACGGCATCT
CAGGCTTGTATGTGGCACGAGCGCTGGACCATGCGGCGCGCTTCAGGGGC
TACCCCAAAGCGCTGCGCACGGACCAAGGGCCGGAGTTCACGAGCCGAGC
GCTGGACCAGTGGGCATACGCCAGCGGCGTGTCCCTGAAATTGATTCAGG
CTGGCAAACCGACGCAGAATGCCTACATCGAGTCGTTCAACGGCAAGTTC
CGAGACGAATGCCTGAATGAGCACTGGTTCACGAGCCTTGCCCATGCACG
CGCTGTCATCGCGGCGTGGCGCCAGGATTACAACGAGGCGCGGCCGCACA
GCGCCTTGAATTACCAACCGCCTGCAGAATTCGCAGCGCGGTATCGAGCA
ACAGCGGTGGCTCCTGCCGCTCAGGAGCAAACTTGAATTGGGCTTTACTA
GAAGCCCTCTGGCCCTGTTGCCGGGGGCAGGTCA
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one Gn628lmg)