Ralstonia solanacearum str. GMI1000

  1. RS05920ISRso14RS05920 ISRso14

RS05920
RSp1215
RSp1215
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSp1216
RSp1216
ID ISRso14
AC RS05920
LO RS05920
OR AL646053 from 1547463 to 1548696 on strand +
DE ISRso14
CL
PM
AN
SQ 1234 nt
 
........10........20........30........40........50
| | | | |
TGACCTGCCCCCAATAAACCGGTCCACCGGGAAGCTAGTAGAGTCCGTTT
TCGGAGAGGAAGACGGACATGAAGAAGCGGTTTACGGAAGCGCAAATCAT
CGGGTTCCTGAAGGAGGCCGAGGCCGGCGTGGCGGTCAAGGAGCTGTGCA
GGAAGCACGGATTCAGTGACGCATCGTTCTACACCTGGCGGGCCAAGTTC
GGCGGGATGGAGGTGTCGGAGGCCCGGCGGCTCAAGGAGCTGGAAGCCGA
GAACGCCAAGCTGAAGAAGCTGCTGGCCGAAGCGATGCTGGACATGGAAG
CGCTGAAGGTGGTGGTCAAGGGAAAGCCCTGAGCCCGCAAGCCAAGCGCG
AGGCGGTCGTGGCGATTCGGCGGAAGGTCAGCATCTCCGAGCGTCGCGCC
TGCCGGCTTGTCGGGCTGTCCCGCAGCGTGCTGCATTACGAAGCGCAAAC
TGCGCCAGGAAACGAGATACTCAAAGCGCGGCTGGTTGAGCTGGCGCATG
AGCGTCGGCGCTTTGGTTACCGGCGACTGCACGTTCTGCTGGAGCGCGAG
GGTCTGCACGCGAATCACAAACGCGTACACCGGTTATATCGCGAGGCTGG
CTTGGCTGTGCGGCGTCGGCGGCGACGCCACGGCGTGATGGTCGAGCGCG
AGCGACTGGCTCTGCCGGCCGCGCCGAACGAGGTCTGGTCGATAGACTTC
GTGATGGACGCGTTGTCCAATGGGCGTCGCCTGAAGTGCCTGACCATCGT
TGATGACTTCACGAAAGAAGCGGTCGACATCGTCGTAGACCACGGCATCT
CAGGCTTGTATGTGGCACGAGCGCTGGACCATGCGGCGCGCTTCAGGGGC
TACCCCAAAGCGCTGCGCACGGACCAAGGGCCGGAGTTCACGAGCCGAGC
GCTGGACCAGTGGGCATACGCCAGCGGCGTGTCCCTGAAATTGATTCAGG
CTGGCAAACCGACGCAGAATGCCTACATCGAGTCGTTCAACGGCAAGTTC
CGAGACGAATGCCTGAATGAGCACTGGTTCACGAGCCTTGCCCATGCACG
CGCTGTCATCGCGGCGTGGCGCCAGGATTACAACGAGGCGCGGCCGCACA
GCGCCTTGAATTACCAACCGCCTGCAGAATTCGCAGCGCGGTATCGAGCA
ACAGCGGTGGCTCCTGCCGCTCAGGAGCAAACTTGAATTGGGCTTTACTA
GAAGCCCTCTGGCCCTGTTGCCGGGGGCAGGTCA
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one 4Yqy3mty)