Ralstonia solanacearum str. GMI1000

  1. RS05919ISRso13RS05919 ISRso13

RS05919
RSc1863
RSc1863
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSc1864
RSc1864
ID ISRso13
AC RS05919
LO RS05919
OR AL646052 from 2047824 to 2049290 on strand +
DE ISRso13
CL
PM
AN
SQ 1467 nt
 
........10........20........30........40........50
| | | | |
CACCCCTTTCAAGGTCTTGTCGCACAGAAGTGCCGTATTCTTCCGCTCGC
CTTGAGGAAACGGGAGAGAGGAAATCTGGCAAGCCGTTGTAGAGCGATTT
GAGGAGCATGCGCCGGCGAGCGTGATGGCGCGTCTGGCGCTGGAGCGGGC
GTTGCCGGCTACGTGGGTGGACGAGGTATTCGAAGTGCATCGAAATCGCC
AGTACCCGCGAGAGCTGATGTTCTCCACCATCGTGGAGCTGATGACGTTG
GTGACCCTGGGGCTGCGTCCTTCGTTACATGCGGCCGCGCGCAAGATGGG
CAATCTGCCGGTGTCAATGGCAGCGCTGTACGACAAGCTCAACCGCACAG
AGCCAGCGATTCTGCGAGGCTTGGTACGCGGCAGCGCACAGCGTTTGGCG
CAGGTGGCGGTGCACCTGGATGAGCGCACCAGCCTGCCGGGCTGGCAGTT
GCGCATCGTAGACGGCAACCATCTACCGGCCAGCGAGAAGCGGCTGGGGC
CGCTACGCGGCTATCGTGGCGCCGCGCTGCCTGGGCACAGCTTGGTGGTC
TACGACCCGGATCTGGGCTTGGTGTGCGATGTGGTGGCCTGCGAGGATGC
GTACGAAAGCGAGCGAGCCGGCATGCAGCCCTTGCTCGACAGTGCCCAAG
CCGGGCAATTGTGGATAGCGGATCGGCACTTCTGCACCCACACCATCATG
CAAGGCTGGAGTCGGGCGGGAGCGGAATTCATCGTGCGCGAGCATGCGCG
CCACCCGCGACTAAGCCGGCATGGCTGCTGGAGTGGGTACAAGCGTATCG
ACACGGGCCGCGTGCGCGAGCAGGCCATCGAAGTGCGAGTCGTTCACGAT
GACGAGTGCCAAGCCAGGCCGCCAAGTTGGCGCCGCATCGAGATCGAACT
GGACACGCCTACCGAGGCCGGCGAAACCGTGATCGGGCTGTGGAGCAATC
TGCCTGCCCAGGTCGATGCGGCAACGATCGCTGCGCTGTACCGCAAGCGC
TGGCGCATCGAGAGCATGTTCCAGCGCCTGGAGTCGGTGCTGCACAGCGA
GATCAAGAGTCTGGGGCATCCCCGAGCGGCTTTACTGGGCTTCACGGTGG
CGGTGCTGGCCTATAACGTCGTGTCACTGCTGCAGCGTGCCGTCGAGCAG
GCGCACCATGAATCGGCGCCGCAGTTGGAGGTCTCCAGCTATCACCTGGC
CGAGCACATCAAAAGCGGCTATGAGGGCATGCTGATCGCTTTGCCAGCCG
AGCACTGGCCCAGTGCGGCCGAAGCGTCTGCGCAGTCGCTGGCTCAAAGG
CTGTTGCACTTGGCGCGGCGCATCTCACCCACGCAAGTGGCCACGAGCAA
ACGCGGCCCCAAGATCGACAAGCCCACGGGCTATGTGGACGGCAGCATCG
CCCGAGCCCATGTCTGCACTGCCCGCGTACTCAAAAAGGCCCGGGCGGAA
AGACCTTGAAAGGGGTG
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one L3h37z4S)