Ralstonia solanacearum str. GMI1000

  1. RS05914ISRso13RS05914 ISRso13

RS05914
RSp1148
RSp1148
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSp1149
RSp1149
ID ISRso13
AC RS05914
LO RS05914
OR AL646053 from 1448757 to 1450223 on strand -
DE ISRso13
CL
PM
AN
SQ 1467 nt
 
........10........20........30........40........50
| | | | |
CACCCCTTTCAAGGTCTTGTCGCACAGAAGTGCCGTATTCTTCCGCTCGC
CTTGAGGAAACGGGAGAGAGGAAATCTGGCAAGCCGTTGTAGAGCGATTT
GAGGAGCATGCGCCGGCGAGCGTGATGGCGCGTCTGGCGCTGGAGCGGGC
GTTGCCGGCTACGTGGGTGGACGAGGTATTCGAAGTGCATCGAAATCGCC
AGTACCCGCGAGAGCTGATGTTCTCCACCATCGTGGAGCTGATGACGTTG
GTGACCCTGGGGCTGCGTCCTTCGTTACATGCGGCCGCGCGCAAGATGGG
CAATCTGCCGGTGTCAATGGCAGCGCTGTACGACAAGCTCAACCGCACAG
AGCCAGCGATTCTGCGAGGCTTGGTACGCGGCAGCGCACAGCGTTTGGCG
CAGGTGGCGGTGCACCTGGATGAGCGCACCAGCCTGCCGGGCTGGCAGTT
GCGCATCGTAGACGGCAACCATCTACCGGCCAGCGAGAAGCGGCTGGGGC
CGCTACGCGGCTATCGTGGCGCCGCGCTGCCTGGGCACAGCTTGGTGGTC
TACGACCCGGATCTGGGCTTGGTGTGCGATGTGGTGGCCTGCGAGGATGC
GTACGAAAGCGAGCGAGCCGGCATGCAGCCCTTGCTCGACAGTGCCCAAG
CCGGGCAATTGTGGATAGCGGATCGGCACTTCTGCACCCACACCATCATG
CAAGGCTGGAGTCGGGCGGGAGCGGAATTCATCGTGCGCGAGCATGCGCG
CCACCCGCGACTAAGCCGGCATGGCTGCTGGAGTGGGTACAAGCGTATCG
ACACGGGCCGCGTGCGCGAGCAGGCCATCGAAGTGCGAGTCGTTCACGAT
GACGAGTGCCAAGCCAGGCCGCCAAGTTGGCGCCGCATCGAGATCGAACT
GGACACGCCTACCGAGGCCGGCGAAACCGTGATCGGGCTGTGGAGCAATC
TGCCTGCCCAGGTCGATGCGGCAACGATCGCTGCGCTGTACCGCAAGCGC
TGGCGCATCGAGAGCATGTTCCAGCGCCTGGAGTCGGTGCTGCACAGCGA
GATCAAGAGTCTGGGGCATCCCCGAGCGGCTTTACTGGGCTTCACGGTGG
CGGTGCTGGCCTATAACGTCGTGTCACTGCTGCAGCGTGCCGTCGAGCAG
GCGCACCATGAATCGGCGCCGCAGTTGGAGGTCTCCAGCTATCACCTGGC
CGAGCACATCAAAAGCGGCTATGAGGGCATGCTGATCGCTTTGCCAGCCG
AGCACTGGCCCAGTGCGGCCGAAGCGTCTGCGCAGTCGCTGGCTCAAAGG
CTGTTGCACTTGGCGCGGCGCATCTCACCCACGCAAGTGGCCACGAGCAA
ACGCGGCCCCAAGATCGACAAGCCCACGGGCTATGTGGACGGCAGCATCG
CCCGAGCCCATGTCTGCACTGCCCGCGTACTCAAAAAGGCCCGGGCGGAA
AGACCTTGAAAGGGGTG
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one F6fzaXm6)