Ralstonia solanacearum str. GMI1000

  1. RS05912ISRso12RS05912 ISRso12

RS05912
RSc1437
RSc1437
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSc1438
RSc1438
ID ISRso12
AC RS05912
LO RS05912
OR AL646052 from 1541741 to 1542965 on strand +
DE ISRso12
CL
PM
AN
SQ 1225 nt
 
........10........20........30........40........50
| | | | |
TGACCTCCCCCCGAAATATTGGACACGCCAGAACAGGAGAAAACCGGCGA
CACTGCCCTTGAAGGAGGGAGTTCGCCATGAAGAAGTCGAAGTTCACGGA
AGAGCAGATTGCGTTCGCGCTGCATCAGGCCGAGACAGGTGTCTCGGTCG
AAGAGGTATGCCGCAAGATTGGCATCTCGCAAGCGACGTTTTACGCGTGG
AAGAAGAAGTACGGCGGTATTGGCGTGAGCGAGCTACGGCGGTTGCGTCA
ACTTGAAGAGGAGAACGCCAAGCTGCGGCGCTTGGTGGCCGACTTGAGCC
TGGACAAGGTCATGCTGCAGGATGTTCTGAGAAAAAAGCTCTAAGGCCGG
CGCAGCGCAAAGCGCTCGTCGGCCATCTCATCGAACGGTACCGCGTCAGC
ATTAAACGCGCCTGCCAGGTCTGCCGGCAAAGCCGCGCAGGTTGGTACCA
GAAGCCGAAACCGAGGCTGCTGGACGCACCGATCAAGGCCCGCATGCACG
AGATCGCCAGCACCCGGGTACGGTACGGCTTCTGGCGCATTTACGTGCTG
ATTCGTCGCGAGGGTTGGTTGGTCAATCACAAACGCGTCTACCGCCTGTA
CAAGGAGGAAGGCTTGAATCTGCGCACCAAAAGACCCAGGCGCCGCAAGG
CGGCCGCACATAGACTCGAGCGCCCGGTGCTCACCGCACCGAATCAGAGC
TGGAGCATGGATTTCGTATCCGACGCCTTGTTTAACGGCAACAAGTTCCG
CGCACTGACTGTGGTGGACAACCATACGCGGGAATGCCTGGCGATTGAGG
CTGCCCCGTCGCTAAACGGCAGTGACGTTGTGCGTGTGTTGCAAGCCATC
GTGATCCGACGAGGCATGGTGCCCGCACGCATCCAGGCTGACAACGGGCC
GGAATTTGTGTCGCTGGCGCTGGACAAGTGGGCGTATGAGGCAGGCGTAA
CGCTCGACTTCTCTCGGCCTGGCAAGCCTACCGACAATGCCTTCATCGAG
TCCTTCAACGGCAGCTTGCGCGATGAATGCCTGAACACGTACTGGTTCCT
GTCCCTTGAAGACGCACGCCAAAAGCTCGAAAACTGGAGGCACGATTACA
ATCATTTCCGGCCACATTCGGCGCTGGATGACACCGCACCAGCGCTCTTT
GCACGGCAGTTTGCCATTACACCAACCACGCCGGCTTCTCTAGCCTGACC
CTGTCCAGTTCTTGGGAGGAGGTCA
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one 4mpimR3s)