Ralstonia solanacearum str. GMI1000

  1. RS05911ISRso12RS05911 ISRso12

RS05911
RSc2705
RSc2705
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSc2706
RSc2706
ID ISRso12
AC RS05911
LO RS05911
OR AL646052 from 2910961 to 2912185 on strand -
DE ISRso12
CL
PM
AN
SQ 1225 nt
 
........10........20........30........40........50
| | | | |
TGACCTCCCCCCGAAATATTGGACACGCCAGAACTGGAGAAAACCGGCGA
CACTGCCCTTGAAGGAGGGAGTTCGCCATGAAGAAGTCGAAGTTCACGGA
AGAGCAGATTGCGTTCGCGCTGCATCAGGCCGAGACAGGTGTCTCGGTCG
AAGAGGTATGCCGCAAGATTGGCATCTCGCAAGCGACGTTTTACGCGTGG
AAGAAGAAGTACGGCGGTATTGGCGTGAGCGAGCTACGGCGGTTGCGTCA
ACTTGAAGAGGAGAACGCCAAGCTGCGGCGCTTGGTGGCCGACTTGAGCC
TGGACAAGGTCATGCTGCAGGATGTTCTGAGAAAAAAGCTCTAAGGCCGG
CGCAGCGCAAAGCGCTCGTCGGCCATCTCATCGAACGGTACCGCGTCAGC
ATTAAACGCGCCTGCCAGGTCTGCCGGCAAAGCCGCGCAGGTTGGTACCA
GAAGCCGAAACCGAGGCTGCTGGACGCACCGATCAAGGCCCGCATGCACG
AGATCGCCAGCACCCGGGTACGGTACGGCTTCTGGCGCATTTACGTGCTG
ATTCGTCGCGAGGGTTGGTTGGTCAATCACAAACGCGTCTACCGCCTGTA
CAAGGAGGAAGGCTTGAATCTGCGCACCAAAAGACCCAGGCGCCGCAAGG
CGGCCGCACATAGACTCGAGCGCCCGGTGCTCACCGCACCGAATCAGAGC
TGGAGCATGGATTTCGTATCCGACGCCTTGTTTAACGGCAACAAGTTCCG
CGCACTGACTGTGGTGGACAACCATACGCGGGAATGCCTGGCGATTGAGG
CTGCCCCGTCGCTAAACGGCAGTGACGTTGTGCGTGTGTTGCAAGCCATC
GTGATCCGACGAGGCATGGTGCCCGCACGCATCCAGGCTGACAACGGGCC
GGAATTTGTGTCGCTGGCGCTGGACAAGTGGGCGTATGAGGCAGGCGTAA
CGCTCGACTTCTCTCGGCCTGGCAAGCCTACCGACAATGCCTTCATCGAG
TCCTTCAACGGCAGCTTGCGCGATGAATGCCTGAACACGTACTGGTTCCT
GTCCCTTGAAGACGCACGCCAAAAGCTCGAAAACTGGAGGCACGATTACA
ATCATTTCCGGCCACATTCGGCGCTGGATGACACCGCACCAGCGCTCTTT
GCACGGCAGTTTGCCATTACACCAACCACGCCGGCTTCTCTAGCCTGACC
CTGTCCAGTTCTTGGGAGGAGGTCA
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one jVwMcRvv)