Ralstonia solanacearum str. GMI1000

  1. RS05910ISRso12RS05910 ISRso12

RS05910
RSp0502
RSp0502
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSp0503
RSp0503
ID ISRso12
AC RS05910
LO RS05910
OR AL646053 from 625098 to 626322 on strand +
DE ISRso12
CL
PM
AN
SQ 1225 nt
 
........10........20........30........40........50
| | | | |
TGACCTCCCCCCGAAATATTGGACACGCCAGAACAGGAGAAAACCGGCGA
CACTGCCCTTGAAGGAGGGAGTTCGCCATGAAGAAGTCGAAGTTCACGGA
AGAGCAGATTGCGTTCGCGCTGCATCAGGCCGAGACAGGTGTCTCGGTCG
AAGAGGTATGCCGCAAGATTGGCATCTCGCAAGCGACGTTTTACGCGTGG
AAGAAGAAGTACGGCGGTATTGGCGTGAGCGAGCTACGGCGGTTGCGTCA
ACTTGAAGAGGAGAACGCCAAGCTGCGGCGCTTGGTGGCCGACTTGAGCC
TGGACAAGGTCATGCTGCAGGATGTTCTGAGAAAAAAGCTCTAAGGCCGG
CGCAGCGCAAAGCGCTCGTCGGCCATCTCATCGAACGGTACCGCGTCAGC
ATTAAACGCGCCTGCCAGGTCTGCCGGCAAAGCCGCGCAGGTTGGTACCA
GAAGCCGAAACCGAGGCTGCTGGACGCACCGATCAAGGCCCGCATGCACG
AGATCGCCAGCACCCGGGTACGGTACGGCTTCTGGCGCATTTACGTGCTG
ATTCGTCGCGAGGGTTGGTTGGTCAATCACAAACGCGTCTACCGCCTGTA
CAAGGAGGAAGGCTTGAATCTGCGCACCAAAAGACCCAGGCGCCGCAAGG
CGGCCGCACATAGACTCGAGCGCCCGGTGCTCACCGCACCGAATCAGAGC
TGGAGCATGGATTTCGTATCCGACGCCTTGTTTAACGGCAACAAGTTCCG
CGCACTGACTGTGGTGGACAACCATACGCGGGAATGCCTGGCGATTGAGG
CTGCCCCGTCGCTAAACGGCAGTGACGTTGTGCGTGTGTTGCAAGCCATC
GTGATCCGACGAGGCATGGTGCCCGCACGCATCCAGGCTGACAACGGGCC
GGAATTTGTGTCGCTGGCGCTGGACAAGTGGGCGTATGAGGCAGGCGTAA
CGCTCGACTTCTCTCGGCCTGGCAAGCCTACCGACAATGCCTTCATCGAG
TCCTTCAACGGCAGCTTGCGCGATGAATGCCTGAACACGTACTGGTTCCT
GTCCCTTGAAGACGCACGCCAAAAGCTCGAAAACTGGAGGCACGATTACA
ATCATTTCCGGCCACATTCGGCGCTGGATGACACCGCACCAGCGCTCTTT
GCACGGCAGTTTGCCATTACACCAACCACGCCGGCTTCTCTAGCCTGACC
CTGTCCAGTTCTTGGGAGGAGGTCA
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one FLDfGqNI)