Ralstonia solanacearum str. GMI1000

  1. RS05908ISRso10RS05908 ISRso10

RS05908
RSp0459
RSp0459
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSp0460
RSp0460
ID ISRso10
AC RS05908
LO RS05908
OR AL646053 from 577497 to 578831 on strand -
DE ISRso10
CL
PM
AN
SQ 1335 nt
 
........10........20........30........40........50
| | | | |
TGGAACGGCCCCCAGAATCCCCGGACACAGTCACCCACTTAAACTACGGG
TAGGCATACGACTGTGTTTATGACTAGCAGCAACCAAGAAGTGATGGAAG
TGTTGACGGGCCCGGAGCGTCGCCGGCGGTGGTCGGTGGAAGAGAAGCTT
GCGATGGTCCGAGAGAGCTTTGAGCCGGGCAAGACGGTCTCGATGGTGGC
GCGCCAGCACGGCGTGAATCCGAATCAGGTGTTCCAGTGGCGCAAGCTGT
ACCAAGACGGGAGCCTGTCGGCAGTGACCGCGGGCGAGGAAGTGGTGCCG
GCCTCGGAGCTGGCCGAAGCGCTCAAACAAGTCCGTGAGCTGCAGCGCAT
GCTCGGCAAGAAGACGATGGAGAACGAGATTCTTCGCGAAGCCGTGGAAT
ACGGTCGGGCAAAAAAGTGGATAGCGCGCTCGCCATCGTTGCCGGGGGAC
GACCAGTGAAGCTAGTTTGCGAGGTCCTCGGCGTAGCGCGCTCAAACGTG
GCGGCCAAGCGGGCCCGGCCGGGTGATTGGCGCGACGGGCGCACAGCTCG
GCAAACCGACGACGCTAGCTTGGTCGACGAAATCCGGCGCACCATCGCCG
ACTTGCCGAGCTATGGCTACCGGCGGGTCTGGGGCAGATTGCGGCGCGAA
CGTGAGCGTCAATGCGAAGCGCCGATCAATGCCAAGCGTGTCTATCGGGT
CATGCGTGTGCACAGCTTGCTGCTTGAGCGCAGGCCGACGCCACCGCGTC
CACCGCGCCGGCATGACGGCAAGGTCGCCGTGGCCAAGAGCAACCAGCGC
TGGTGCTCCGATGGCTTCGAGTTCCGCTGCGACAACGGCGAGCCGCTGCG
GGTGACGTTCGCGCTGGATTGCTGCGACCGCGAGGCGATGAGCTGGGTGG
CGACGACCGGCGGCTACAGCGGCGACGTAGTACGCGACGTGATGCTGGCG
GCCGTCGAGCAGCGCTTCGGCAATGTTCCGAAAGCGCCAGCGGAAATTGA
ATGGCTGACGGACAACGGCTCAGGCTACATTGCTGGGAAGACTCGCGAGT
TCGCCACGGACATTGGCTTGAAGCCATTGACGACACCGGTTTGCAGCCCG
CAGAGCAACGGCATGGCCGAGAGCTTCGTGAAGACGATGAAGCGCGACTA
CGTCGCCTTCATGCCCAAGCCTGACGCGGCCACAGCGACGCGCAACCTCG
CCATCGCGTTCGAGCATTACAACGAGCAGCATCCCCATAGCGCACTGAAA
TATCGCTCGCCACGCGAGTTCAGGCGCAGGACGGAATCATCAACTCAAGT
GTGAGGCGGTGTCCGGAGATGCGGGGGCAAATCCA
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one 8Li054Ah)