Ralstonia solanacearum str. GMI1000

  1. RS05894ISRso8RS05894 ISRso8

RS05894
RSc2266
RSc2266
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSc2267
RSc2267
ID ISRso8
AC RS05894
LO RS05894
OR AL646052 from 2458033 to 2459319 on strand -
DE ISRso8
CL
PM
AN
SQ 1287 nt
 
........10........20........30........40........50
| | | | |
TGAGCTTCCCTCGAAATTTCGCCTTCCAGCAGGTCGCACGTAAACTCGAC
CCCAAGGAAGGCAAGAAATGTTCAAGGTACCGAAACAGTCATACACGGCG
GAGTTCAAGGCGGCAGCCGTACAACGAGTCAAAGACGGGCAAGGCGTGGG
TGCGGTGGCCCGCGAGTTGAGCGTCTCGGAGCAGACGCTGCGCAACTGGA
TGAAGGCCGAGCAGGCTGGCAAGCTGGGCGGCGCCGGCGCGAAGGTCGTC
ACGCCGGAGCAGATGGAGCTCTCGCGCCTGCGCGCCGAGAACAAGCGGCT
GCAAATGGAACTCGAAATCGCAAAAAAGGCGGCGGCGTACTTCGCGAAAG
ACCTGCTGTGAAGTACGCCTGGATTGACCAGCAGTGTCGGCACTATCCGC
TGTCGGCGCTGTGCGGGGTCCTCTCGGTCAGCGTCAACGGCTATCGTGCC
TGGAGGCGAGGCGGCACGCCCGAGCGCAAGCGGCTCACCGACACGCAATT
GCTCACATTGATTCGGGCCATCCATGCGCAGTTCAAGGGCGCCTATGGCT
CGCCGCGCATGACCGAAGAGATTCGCGCACGCGGGTTCCCGGCCAGCAAA
GCGCGCGTGGAACGCCTGATGAGCCAGAACGGCATCCGGGCACGCCACAA
GCGCCGTTATCGGGTCACGACCGATTCCAGGCACAAGCTGCCGGTCGCGC
CGAACCTGCTGAACCGCGAGTTCACGCCGGCCGAGCCGAATCAGGTGTTC
AGTTCGGACATCACATACATCTGGACCGACGAGGGCTGGCTGTATCTGGC
CGTGGTGCTGGACCTGTTCAATCGGGAAGTCATGGGTTGGTCCATCAAGC
CGCGCATGACGGCAGACCTGGTGACCGACGCACTGACGATGGCGTGGTTC
CGCCGCAAGCCCGCGCCCGGCGCGCTGCATCATTCGGACCGTGGCAGCCA
GTACGCGAGCCACGAATTCCAGCGCAAGCTGGCCGAATACGGCATGCGCT
GTTCGATGAGCCGCAAGGGAAATTGTTGGGACAACGCACCGACTGAGAGC
TTCTTCAACAGCCTGAAGAACGAACGGGTGCATGCCACGCGCTACCGGAC
GCATCAGGAGGCTGCGGCGGACCTGTTCGAATACATCGAAGTGTTTTATA
ACCGCAGTCGCCGTCATTCGTCGCTCGGCTTTGTCTCGCCAGCTCAGTTC
ATGCAGGACTGGCTCAAGGCTCAACAGGTGAAGGAAACGGCTGCATAACC
CAGGGCCTCTGGAAGGCGAAAAACAGAGGGAAGGTCA
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one SOcplsXs)