Ralstonia solanacearum str. GMI1000

  1. RS05893ISRso8RS05893 ISRso8

RS05893
RSc0577
RSc0577
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSc0578
RSc0578
ID ISRso8
AC RS05893
LO RS05893
OR AL646052 from 622247 to 623533 on strand -
DE ISRso8
CL
PM
AN
SQ 1287 nt
 
........10........20........30........40........50
| | | | |
TGAGCTTCCCTCGAAATTTCGCCTTCCAGCAGGTCGCACGTAAACTCGAC
CCCAAGGAAGGCAAGAAATGTTCAAGGTACCGAAACAGTCATACACGGCG
GAGTTCAAGGCGGCAGCCGTACAACGAGTCAAAGACGGGCAAGGCGTGGG
TGCGGTGGCCCGCGAGTTGAGCGTCTCGGAGCAGACGCTGCGCAACTGGA
TGAAGGCCGAGCAGGCTGGCAAGCTGGGCGGCGCCGGCGCGAAGGTCGTC
ACGCCGGAGCAGATGGAGCTCTCGCGCCTGCGCGCCGAGAACAAGCGGCT
GCAAATGGAACTCGAAATCGCAAAAAAGGCGGCGGCGTACTTCGCGAAAG
ACCTGCTGTGAAGTACGCCTGGATTGACCAGCAGTGTCGGCACTATCCGC
TGTCGGCGCTGTGCGGGGTCCTCTCGGTCAGCGTCAACGGCTATCGTGCC
TGGAGGCGAGGCGGCACGCCCGAGCGCAAGCGGCTCACCGACACGCAATT
GCTCACATTGATTCGGGCCATCCATGCGCAGTTCAAGGGCGCCTATGGCT
CGCCGCGCATGACCGAAGAGATTCGCGCACGCGGGTTCCCGGCCAGCAAA
GCGCGCGTGGAACGCCTGATGAGCCAGAACGGCATCCGGGCACGCCACAA
GCGCCGTTATCGGGTCACGACCGATTCCAGGCACAAGCTGCCGGTCGCGC
CGAACCTGCTGAACCGCGAGTTCACGCCGGCCGAGCCGAATCAGGTGTTC
AGTTCGGACATCACATACATCTGGACCGACGAGGGCTGGCTGTATCTGGC
CGTGGTGCTGGACCTGTTCAATCGGGAAGTCATGGGTTGGTCCATCAAGC
CGCGCATGACGGCAGACCTGGTGACCGACGCACTGACGATGGCGTGGTTC
CGCCGCAAGCCCGCGCCCGGCGCGCTGCATCATTCGGACCGTGGCAGCCA
GTACGCGAGCCACGAATTCCAGCGCAAGCTGGCCGAATACGGCATGCGCT
GTTCGATGAGCCGCAAGGGAAATTGTTGGGACAACGCACCGACTGAGAGC
TTCTTCAACAGCCTGAAGAACGAACGGGTGCATGCCACGCGCTACCGGAC
GCATCAGGAGGCTGCGGCGGACCTGTTCGAATACATCGAAGTGTTTTATA
ACCGCAGTCGCCGTCATTCGTCGCTCGGCTTTGTCTCGCCAGCTCAGTTC
ATGCAGGACTGGCTCAAGGCTCAACAGGTGAAGGAAACGGCTGCATAACC
CAGGGCCTCTGGAAGGCGAAAAACAGAGGGAAGGTCA
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one 3ikp0KYC)