Ralstonia solanacearum str. GMI1000

  1. RS05891ISRso8RS05891 ISRso8

RS05891
RSc1548
RSc1548
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSc1549
RSc1549
ID ISRso8
AC RS05891
LO RS05891
OR AL646052 from 1661725 to 1663011 on strand -
DE ISRso8
CL
PM
AN
SQ 1287 nt
 
........10........20........30........40........50
| | | | |
TGAGCTTCCCTCGAAATTTCGCCTTCCAGCAGGTCGCACGTAAACTCGAC
CCCAAGGAAGGCAAGAAATGTTCAAGGTACCGAAACAGTCATACACGGCG
GAGTTCAAGGCGGCAGCCGTACAACGAGTCAAAGACGGGCAAGGCGTGGG
TGCGGTGGCCCGCGAGTTGAGCGTCTCGGAGCAGACGCTGCGCAACTGGA
TGAAGGCCGAGCAGGCTGGCAAGCTGGGCGGCGCCGGCGCGAAGGTCGTC
ACGCCGGAGCAGATGGAGCTCTCGCGCCTGCGCGCCGAGAACAAGCGGCT
GCAAATGGAACTCGAAATCGCAAAAAAGGCGGCGGCGTACTTCGCGAAAG
ACCTGCTGTGAAGTACGCCTGGATTGACCAGCAGTGTCGGCACTATCCGC
TGTCGGCGCTGTGCGGGGTCCTCTCGGTCAGCGTCAACGGCTATCGTGCC
TGGAGGCGAGGCGGCACGCCCGAGCGCAAGCGGCTCACCGACACGCAATT
GCTCACATTGATTCGGGCCATCCATGCGCAGTTCAAGGGCGCCTATGGCT
CGCCGCGCATGACCGAAGAGATTCGCGCACGCGGGTTCCCGGCCAGCAAA
GCGCGCGTGGAACGCCTGATGAGCCAGAACGGCATCCGGGCACGCCACAA
GCGCCGTTATCGGGTCACGACCGATTCCAGGCACAAGCTGCCGGTCGCGC
CGAACCTGCTGAACCGCGAGTTCACGCCGGCCGAGCCGAATCAGGTGTTC
AGTTCGGACATCACATACATCTGGACCGACGAGGGCTGGCTGTATCTGGC
CGTGGTGCTGGACCTGTTCAATCGGGAAGTCATGGGTTGGTCCATCAAGC
CGCGCATGACGGCAGACCTGGTGACCGACGCACTGACGATGGCGTGGTTC
CGCCGCAAGCCCGCGCCCGGCGCGCTGCATCATTCGGACCGTGGCAGCCA
GTACGCGAGCCACGAATTCCAGCGCAAGCTGGCCGAATACGGCATGCGCT
GTTCGATGAGCCGCAAGGGAAATTGTTGGGACAACGCACCGACTGAGAGC
TTCTTCAACAGCCTGAAGAACGAACGGGTGCATGCCACGCGCTACCGGAC
GCATCAGGAGGCTGCGGCGGACCTGTTCGAATACATCGAAGTGTTTTATA
ACCGCAGTCGCCGTCATTCGTCGCTCGGCTTTGTCTCGCCAGCTCAGTTC
ATGCAGGACTGGCTCAAGGCTCAACAGGTGAAGGAAACGGCTGCATAACC
CAGGGCCTCTGGAAGGCGAAAAACAGAGGGAAGGTCA
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one DhGLI2ql)