Ralstonia solanacearum str. GMI1000

  1. RS05889ISRso7RS05889 ISRso7

RS05889
RSc0251
RSc0251
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSc0252
RSc0252
ID ISRso7
AC RS05889
LO RS05889
OR AL646052 from 282785 to 284128 on strand +
DE ISRso7
CL
PM
AN
SQ 1344 nt
 
........10........20........30........40........50
| | | | |
GGGCCTGTCAGTAATTTCGTGTTCAAGGCATAACATGCTCGCAAGGAGAC
GTTATGCCTCGCAAACTGAAAGCCAAGCCGGTGGACCTGCCGGCGATCCC
CGCCGAACTGCTCGAACAATTCGGCAACGGCCCGATGACGGCCGAAGCCA
TCAATGCCGCGACACTGGCCCTCAAGAAGGCCCTGATCGAACGGGCGCTG
AGCGGCGAGATGAATCACCATCTCGGCTACCCGCCTGGCGCCGCCAAACC
GGCCACCGTTACCAACCAGCGCAACGGCTCGGGCGCCAAGACGGTTCTGA
CCGAGGACGGCCCGATCCGCATCGAGGTACCGCGCGACCGTGACGGCAGC
TTCGAACCGCTGCTCATTCCCAAACACGAGCGACGCTTCAAGGGCTTTGA
CGACAAGATCGTCGCCATGTACGCCCGGGGCATGACCGTGCGCGAGATCC
AAGGCTTCCTGCTGGAGCAATATGCAACGGAAGTCTCCCCCGAGTTCATC
AGCTCGGTCACCGATGAGGTGATGGCCGAAGTCACCGCGTGGCAGGCCCG
GCCACTCGATCCCATGTATCCGGTCGTGTTCTTCGACGCGCTGCGGGTCA
AGATCCGGGAAGACGCCGTGGTGCGCAACAAGGCCGTCTATCTGGCGCTG
GGGGTTCTGCCCGACGGCACGCGTGACATTCTGGGCCTGTGGATCGAAAA
CACCGAGGGCGCCAAGTTCTGGATGAAGGTGTTCAACGACCTGAAGACGC
GCGGGGTCAATGACATCCTGATCGCCGTGACGGACGGCCTCAAAGGCATG
CCCGAAGCGCTGGCGGCCGTGTTCCCGGCGACCACGCTGCAGACCTGCAT
CGTCCACCTGATCCGCAACAGCCTGGATTACGCGAGCTGGAAGGACCGCC
GTGAGCTGGCCGCCGCGATCCGGCCGATCTACACAGCGGCGAGCGCAGAG
GCCGCACAGGCCGAGCTCGATGCGTTTGCCGACGGCCCGTGGGGGCAGAG
ATACCCGACGGTGTGCGCCGCCTGGCGCAACGCCTGGGATCGCGTGATTC
CGTTCTTTGCGTTCCCACCGGCGGTGCGCAAGGTGATTTACACGACGAAC
GCCATCGAGAACATCAACGCCCAACTACGCAAGATCATCAAGACCCGAGG
CCACTTCCCGACCGATGATGCAGCAACGAAGCTCATCTGGCTTGCACTGC
GCAACATCACGGCGGGTTGGAGCCGTGCCGCTCACGATTGGAAGCAGGCC
ATGAACCAATTCGCTATCCTCTACGCGGAGCGATTCGTTCGACCGTCCGT
ATGAATCTCAACCCCGCCTTGAACACGGAAATCCTGACACTCCC
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one pOm0io9c)