Ralstonia solanacearum str. GMI1000

  1. RS05887ISRso6RS05887 ISRso6

RS05887
RSc2332
RSc2332
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSc2333
RSc2333
ID ISRso6
AC RS05887
LO RS05887
OR AL646052 from 2531573 to 2533636 on strand +
DE ISRso6
CL
PM
AN
SQ 2064 nt
 
........10........20........30........40........50
| | | | |
TGTCACACGCAGTTGTAAATTGATACGCGGACGCACTTTGGAATTGATAC
ACCTCGTTGTAGGGTCGTCCTTTTTGGGCGCCCGTGATCAGCTACGAGGA
TTACATGGAAGTACAGATTCTGCGTCGCCAGGGCTGCAGTTTGCGTGCGA
TCGCAACCGAGACTGGCATGGCCGTGAACACCATCAGGAAGTACCTGGTG
TCCGGCGCGCCCGAGCGCAAGCCACGCGAGCCGGTGGTGGGCAAGTTGGA
GCCGTTCAAGGCCTTCATACAGTCCCGCGTTGACGCCGCACGTCCGGACT
GGATTCCGGCGACGGTGCTGTTGCGCGAGATCGAGGAGCGTGGGTACACC
GGCAAGCTGCGCATTGTTCAGGAATACCTGCAAACGCTGCGGCCCGCCAG
CCGGCCCGATCCGGTTGTGCGGTTCGAGACGGAACCCGGCCAGCAAATGC
AGATGGATTGGATCGAATTCCGCAAGACCGGGCACAAGCACGGCATGCTG
GCGGCATTCGTTGCCACGTTGGGATACAGCCGAGCCAGCTATGTCGAGTT
CGTTTCCGACATGCGCCTGGAGACCTTGCTCACCTGCCATGTGCGTGCAT
TCGATGCCTTTGGCGGAGTCACCAAGGAGATCCTGTACGACAACATGAAG
ACGGTGATCCTGCAGCGCAATGCCTACGGTAAGCAACAGCATCGGTACCA
ACCAGGCTTTGCCGACTTCGCCAAGCACTATGGGTTCGCGCCGCGCGTGT
GCAAGCCCTACCGGGCGAAGACGAAGGGCAAAGTCGAGCGGATGAACGGC
TACCTGCGCTACAGCTTCTGGGTCCCGTTGGCTTCCAAGCTCAAGCAGAT
CGGCTTGGCTGCGGACAAGGATCTGTGCAATCAACAGGTTGGCCTCTGGC
TGCGGGATGTGGCCAATGTCCGCGTTCACGGCACGACGAAGCGCGTTCCC
GTGGACGTCCTGAGAGAGGAACGACCGCATCTGCTGCCAACGCCGGCACT
CTATGCCGGGCGATCGGTGCGCGCCGGTGCAACGCCTCACGAGACGCCCA
AGCCGGCCTCCAGGTTTGCGACGCCGGACTGGCATGTCTGCTTGCAGCAC
CCGCTGTCCGTCTACGATTCCTTCTGCCAGCAGGGAGTCGCCGCATGACG
CCTCAGCTCGAACGGCTCACCGTCCTGTGCCAGCAGCTCAACCTGCAGCA
CCTTCCCACACAGCTCGCCCACCTGGGCCAGATGGCGGCCAAGCGGGAGC
TCGGCTACCTGGACTTCCTTGAGCACGCCTTGAAGGACGAAGCCATGGCG
CGGGCCGAGCGCATGCGACGAACGCTGACACGATTGGCCGGCTTCCCGGC
GATCAAGACCTTGGACGAGTTCGACTTCGAGTTCGCAACCGGCGTGCCGA
AGGCGATGGTCCTGGAGTTGGGCAGCCTTGCATTCGTTGAGCGAGCCGAG
AACGTGGTGCTGCTCGGACCTTCCGGCGTGGGGAAGACCCACCTGGCGAT
CGCCCTGGGCTATCGCGCCACGCAGGCCGGCATGCGGACGCGGTTCATCA
CGGCGGCCGATCTGCTGATGCAACTTGCAGCCGCCCTGCAGCGGAACCAG
CTCGATGTCGCCATCAAGCGCATTGTGAATCCCTACAAGCTCTTGATCGT
TGACGAGATGGGCTACCTGCCGATGGACCGAGAACAAGCCAATCTACTGT
TCCAGGTCATTGCTAAGCGGTATGAAACCGGAAGCTTGGTGCTGACGAGC
AATCTGCCCTTCGGTCAATGGGATCAGACCTTTGCTGGCGACGCCACGCT
CACTGCCGCTCTGCTAGATCGCCTGCTGCATCACGCGCACGTTGTGCCGA
TCTCCGGCGACTCGTACCGACTGAAGGAGAAGCGCCAGGCGGGCATGATC
CATCGAATGTCGCTGTCGAATCCTGTGCCCGACGACCTCAAACGCAAACG
CATTCCAAAGGAGCCACCGCCCAGCCACCCGATGCAATAACCATCAGAGG
GGGTGTATCAATTTACAAATGCGTTTGCACCTGAATCTGTATCAACTTGA
GACTGCGTTTGACA
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one 4O7ld2tY)