Ralstonia solanacearum str. GMI1000

  1. RS05884ISRso5RS05884 ISRso5

RS05884

Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSc3393
RSc3393
ID ISRso5
AC RS05884
LO RS05884
OR AL646052 from 3659385 to 3660550 on strand -
DE ISRso5
CL
PM
AN
SQ 1166 nt
 
........10........20........30........40........50
| | | | |
CTAGTGTCCTGTTCCGTTGTTAACTGGTCTAAGTTTACATAGGATGTTGG
CATCAACGAAACGGGAGATGCCAGCATGCCAATGGGACGGCCGAAGGCGG
AACTGGTGCTGAGCGAGGACGAGCAGACGCAACTGGCTGGGATGGTGCGT
TCGCGCAGTATCCCGGCGGCGTTGGTGATGCGTGCGCGCCTTGTCTTGGC
GGCGGCCGCAGGCGAGCCCAACAGTGAGATCGCCGAGCGCCTGCAGCTCA
CGCGCGCTACGGTGGGCAAATGGCGCGCCCGGTTCCTTGAGCGGCGCATC
AATGGGTTGTACGACGAACTGCGACCCGGCAAGCCGCGTACCATCGACGA
CGAGCGCGTGGCCGAACTCATCAAGACGACGCTGCATACGAAGCCTGCGG
ATGGCTCGACTCACTGGAGTGTGCGCGCGGTGGCGGCCGAGACATCGATC
TCGCCTACCAGCGTGCACCGCTATTTCAAGCTGTTGGGGCTGCAACCGCA
TCGCAGCGAGACCTTCAAGCTGTCCACCGATGCGTTTTTCATCGAGAAGC
TGCGCGACGTGGTGGGGCTGTATCTGAACCCGCCCGAGAATGCATTGGTG
CTGTGCGTGGACGAGAAGAGCCAGTGCCAGGCACTGGAGCGCACTCAGCC
GATGCTGCCCATGGGGCTGGGCTATGTCGAAGGCGTCACCCACGACTATG
TCCGCCATGGCACAACGACGCTGTTTGCCGCGCTGAACGTACTCAACGGC
GCGGTACTGGCCGAGTGTAAGCCGCGCCATCGGCACCAAGAGTTCCTCGC
CTTCTTGCGCTCGATCGACAAAGCCGTGCCCGCCGACCTCGATGTGCATT
GCATCGTGGATAACTACAGCAGCCATAAGCATCCCAAGGTCAAGGCGTGG
CTGGCGGCCCGTCCGCGCTGGCATATGCACTTCATCCCGACCTACAGCTC
TTGGCTCAATCAGGTCGAACGCTTCTTCGCGATCATTACCGACAAGGCCA
TTCGCCGTGGCTCGTTCACGTCGGTTAAGGAACTGGTTCAGAAGATCGAT
CACTTCGTCGCTCACTACAACCAGAACTGCAAACCATTCGCTTGGACCGC
GACCGCTGATTCAATCCTCTCCAAGCTCAGCAGACTTTGCGAACGAATTA
GCGGAACGGGACACTA
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one dfyRWXTY)