Ralstonia solanacearum str. GMI1000

  1. RS05882IS1021RS05882 IS1021

RS05882
RSp1178
RSp1178
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSp1179
RSp1179
ID IS1021
AC RS05882
LO RS05882
OR AL646053 from 1486430 to 1487637 on strand -
DE IS1021
CL
PM
AN
SQ 1208 nt
 
........10........20........30........40........50
| | | | |
GGAAACGCTGATTTATCAGGCTCGGCGGTCATCGCTGACGTAGCCGAGGA
CGTTGCGGAAGGAAGCTCACGGAGTGGACCGACGACGATGAAGAAGCAAA
CCAGCTTTTCGGAAGCGGAGTACGCGGGCAAGAAACGCGTGACCAAGCGT
GAGCGTTTCCTGGCGGAGATGGAGAAGGTCGTTCCATGGACGCGGCTGGT
TGCGGCAGTCGAGCCGCACTACCCCAAAGGAGAACGAGGACGGCCGCCAA
TCGGGCTGCAGAGGATGCTGCGCATTTATTTCTTGCAGCAGTGGTACGGG
CTGTCGGACGAAGGACTGGAAGATGCGTTGTACGACAGCATGGCGATGCG
TGCGTTCGCCGGCATTGATCTGGCGGTCGAGAACGTGCCGGACGCGACCA
CGCTGCTGAAGTTCCGGCGCCTGCTGGTCGAGCATGACCTGACTGGCAAG
CTGTTCGACGAGATCGGCATCATGCTGTGCGAGCGGGGGCTGATGATGAG
GGAAGGCACGATCGTGGATGCCACCATCATCGAAGCGCCGCCGTCGACCA
AGAATGCCGAGAAGAGCCGCGATCCGGAGATGCACCAGACCAAGAAGGGC
AACGAATGGCACTTTGGAATGAAGGCACACATTGGGGTGGATGCGTCGTC
GGGCCTGGTGCATAGCGTGGTTGGCACGGCAGCGAATGAGTCCGATGTCT
CGCAGGCCCACGCGTTGCTGCATGGCCATGAGGAAGACGCGTTTGGCGAT
GCAGGTTACACCGGCGTTGAGAAGCGCGACGAGATGCAAGGCAAGGGCAC
GAAGTGGCATGTTGCGCTCAAGCGCAGCAAGATCAAGGCGATGCGCGATG
GCGCCATCAAGGACTTGCTAATCGCGGCGGAGAGGACCAAGGCTCAGATT
CGGGCTCGGGTCGAACATCCGTTCCATGTCATCAAGAATCTGTTTGGTCA
TCGCAAGGTTCGTTACAAGGGCTTGGCCAAGAACACGGCGCAACTGTTCA
GCTTGTTCGGTCTCGCCAATCTGGTGCTCGCCAGGAGCCAGTTGCTGGCC
AGCCCTGAAAGCATTCCGTCCTGAGCGCGCAAAGCGCGCCAGGCACCACG
CGAAAACGGCGGAAAACGTGCTCAATCGGCACTTCCTTCCCGCGATGCGG
AAACCTTGAACAGGATGGCTCGCGATTCCATTCACGGACCCCATTGATCA
GCGTTTCC
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one 0FHDG6J1)