Ralstonia solanacearum str. GMI1000

  1. RS05875IS1421RS05875 IS1421

RS05875
RSp0300
RSp0300
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSp0301
RSp0301
ID IS1421
AC RS05875
LO RS05875
OR AL646053 from 395524 to 396387 on strand -
DE IS1421
CL
PM
AN
SQ 864 nt
 
........10........20........30........40........50
| | | | |
GTGCCGCTAACAAAACCAAGTCATCGAACGCAGGTGGTTGAGCGTTGTTG
TTGGCATGGCACGAAAGAAGATCAGCAATGAACTGTGGAAGGCATTGCAA
CCGCTGCTGCCGGTTGTGGAGCCTTCGACCAAAGGCGGTCGTCCGCGCGT
GGATGATCGGGCGGCGCTCAACGGCATCCTGTTTGTTCTGCATACCGGTA
TCCCGTGGGAAGACCTGCCTAAAGAACTGGGCTTTGGCAGCGGCATGACG
TGCTGGCGTCGCCTGCGGGAGTGGCAGGCCAACGGCGTTTGGGAGCGGCT
GCATTTGGCTCTGCTCAAGCGCCTACGCGAACACGACCAGATCGACTGGA
GCCGAGCCAGTGTCGACGGTGCAACGGTGGCCAGCCCCCGGGGGGCGAGC
AGACGGGGCCGAATCCAACGGATCGCGGCAAGCTCGGTAGCAAGCGCCAT
CTCGTCGTAGATCGGCGCGGCGTGCCGTTGGCGCTGATGGTCACCGGTGC
CAATCGTCACGACTCGGTGGTGTTCGAGGTGCTCGTTGACGCCATCCCGA
GCGTGCCCGGACTCGATGGCCGCCCGCGATGCCGCCCCGACAAGCTTCAC
GCGGATAAGGGATACGACTTCGCGCGATGCCGCCGGCATCTGCGCAAGCG
GGGCATGACTCCCCGGATCGCTCGCCGTGGCATCGAGAAGAACGACCGGC
TCGGCAAGCATCGCTGGGTGGTCGAACGCACCCATGCCTGGCTTGCTGGA
TTCGGCAAGTTGCGCATTCGTTTCGAGCGTTCTCTTCAGACTCACCTCGC
TTTGCTCACCCTGGCTTGCGCCGTCATCTGCGGACGATTTGTTGATCGGT
TTTGTTAGCGACTC
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one auFsTxTf)