Ralstonia solanacearum str. GMI1000

  1. RS05872IS1421RS05872 IS1421

RS05872
RSp0092
RSp0092
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence

ID IS1421
AC RS05872
LO RS05872
OR AL646053 from 101428 to 102291 on strand -
DE IS1421
CL
PM
AN
SQ 864 nt
 
........10........20........30........40........50
| | | | |
GTGCCGCTAACAAAACCAAGTCATCGAACGCAGGTGGTTGAGCGTTGTTG
TTGGCATGGCACGAAAGAAGATCAGCAATGAACTGTGGAAGGCATTGCAA
CCGCTGCTGCCGGTTGTGGAGCCTTCGACCAAAGGCGGTCGTCCGCGCGT
GGATGATCGGGCGGCGCTCAACGGCATCCTGTTTGTTCTGCATACCGGTA
TCCCGTGGGAAGACCTGCCTAAAGAACTGGGCTTTGGCAGCGGCATGACG
TGCTGGCGTCGCCTGCGGGAGTGGCAGGCCAACGGCGTTTGGGAGCGGCT
GCATTTGGCTCTGCTCAAGCGCCTACGCGAACACGACCAGATCGACTGGA
GCCGAGCCAGTGTCGACGGTGCAACGGTGGCCAGCCCCCGGGGGGCGAGC
AGACGGGGCCGAATCCAACGGATCGCGGCAAGCTCGGTAGCAAGCGCCAT
CTCGTCGTAGATCGGCGCGGCGTGCCGTTGGCGCTGATGGTCACCGGTGC
CAATCGTCACGACTCGGTGGTGTTCGAGGTGCTCGTTGACGCCATCCCGA
GCGTGCCCGGACTCGATGGCCGCCCGCGATGCCGCCCCGACAAGCTTCAC
GCGGATAAGGGATACGACTTCGCGCGATGCCGCCGGCATCTGCGCAAGCG
GGGCATGACTCCCCGGATCGCTCGCCGTGGCATCGAGAAGAACGACCGGC
TCGGCAAGCATCGCTGGGTGGTCGAACGCACCCATGCCTGGCTTGCTGGA
TTCGGCAAGTTGCGCATTCGTTTCGAGCGTTCTCTTCAGACTCACCTCGC
TTTGCTCACCCTGGCTTGCGCCGTCATCTGCGGACGATTTGTTGATCGGT
TTTGTTAGCGACTC
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one 1yWKx6wq)