Ralstonia solanacearum str. GMI1000

  1. RS05869ISRso1RS05869 ISRso1

RS05869
RSp1301
RSp1301
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSp1302
RSp1302
ID ISRso1
AC RS05869
LO RS05869
OR AL646053 from 1651927 to 1652810 on strand -
DE ISRso1
CL
PM
AN
SQ 884 nt
 
........10........20........30........40........50
| | | | |
GAGCCCGTTTGAAAATTCCCCGCCGTTGTGGTGTAAAGGCGGGATGTGGA
AAAAAGAACATCGAGAACGCGAGGCGAAGCTGGGTCGCAAGACCAAGCGG
TACCCAAGCGACCTGACGGATATCGAATGGGTCGCTGTGCAGCCGTTGCT
GCCCCGCGCCGCCGTGCGAGGTCGGCGTCGGGAGTGCGACTTGAGGGAGG
TGGTCAACGCCTTGCGCTATCTTGTGCGAGCGGGCTGCGGTTGGCGCATG
CTGCCTCACGACTTCCCGCCTTGGCAAACCGTGTATTGGTGGTTTCGTCG
GCTCATGCGTCGCTTGCTGTTCCGCACGCTGCACGACGTGGTGCTGATGT
TGGACCGGGAGTTGGCTGGGCGGCAGCCGTGCCCAAGTGCGGGCGTCATC
GACAGCCAGACAGTCAAAGCGCCCTCGGCCGACAAGCGTGGCTACGACGC
GGCCAAGAAAATCGTCGGGCGCAAGCGGCATATCGCGGTGGACACGGATG
GACGGCTGCTGATGGTGAACCTGACACCGGCGGACATTGCTGATAGCACG
GGTGCGCTGGCGGTGCTGGAAGCGGTGAAGAAGCGCTGGCCAGGCATAAA
ACACCTGTTCGCTGACGGTGCGTATGACCGCACAGCGCTGATGGACAAGG
CATCGACCCTCGACTTCGTGGTTGAGGTGGTGCGCCGGCACGAGCAGCAA
ACGGGCTTTGCCGTTCTGCCGCGCCGCTGGGTGGTCGAGCGCACCTTTGG
ATGGATGGTTCGCTGGCGTCGACTCGTACGCGACTACGAACAGCGGGCAG
ACGTATCGGAAGCCATGATTCATATCGCGATGAGCGGCTTGCTACTGCGC
AGAATCGCTCATCCTTGAATTTTCAAACGGGCTC
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one 9yuWAV4i)