Ralstonia solanacearum str. GMI1000

  1. RS05865ISRso1RS05865 ISRso1

RS05865
RSc3220
RSc3220
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSc3221
RSc3221
ID ISRso1
AC RS05865
LO RS05865
OR AL646052 from 3483308 to 3484191 on strand +
DE ISRso1
CL
PM
AN
SQ 884 nt
 
........10........20........30........40........50
| | | | |
GAGCCCGTTTGAAAATTCCCCGCCGTTGTGGTGTAAAGGCGGGATCTGGA
AAAAAGAACATCGAGAACGCGAGGCGAAGCTGGGTCGCAAGACCAAGCGG
TACCCAAGCGACCTGACGGATATCGAATGGGTCGCTGTGCAGCCGTTGCT
GCCCGGCGCCGCCGTGCGAGGTCGGCGCCGGGAGTGCGACTTGAGGGAGG
TGGTCAACGCGCTGCGGTACCTGGTGCGGGCGGGCTGCGGCTGGCGCATG
CTGCCCCATGACTTCCCGCCGTGGCAGACCGTGTATTGGTGGTTTCGGCG
GCTCATGCGCCGCTTGCTGTTCCGCACGCTGCACGACGTGGTGCTGATGC
TAGACCGGGAGTTGGCTGGGCGGCAGCCGTGCCCGAGTGCGGGCGTCATC
GACAGCCAGACAGTCAAAGCGCCCTCGGCCGACAAGCGTGGCTACGACGC
GGCCAAGAAAATCGTCGGGCGCAAGCGGCATATCGCGGTGGACACGGATG
GACGGCTGCTGATGGTGAACCTGACGTCGGCGGATATTGCCGACAGCACG
GGGGCACTGGCGGTGCTGGAAGCGGTGAAGAAGCGCTGGCCGGGTGTGAA
ACACCTGTTCGCAGACGGCGCCTACGACCGCACGGCGCTGATGGACAGGG
CCGCGACCCTCGACTTCGTGGTTGAGGTGGTGCGCCGGCACGAGCAGCAA
ACGGGCTTTGCCGTTCTGCCGCGCCGCTGGGTGGTCGAGCGCACCTTTGG
GTGGATGGTTCGCTGGCGCCGACTCGTACGCGACTACGAGCAGCGCGCGG
ACGTCTCGGAAGCCATGATTCATATCGCGATGAGCGGCTTGCTACTGCGC
AGAATCGCTCATCGTTGAATTTCCAAACGGGCTC
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one w5Q0RoZH)