Ralstonia solanacearum str. GMI1000

  1. RS05863ISRso1RS05863 ISRso1

RS05863
RSc1008
RSc1008
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSc1009
RSc1009
ID ISRso1
AC RS05863
LO RS05863
OR AL646052 from 1059501 to 1060384 on strand -
DE ISRso1
CL
PM
AN
SQ 884 nt
 
........10........20........30........40........50
| | | | |
GAGCCCGTTTGAAAATTCCCCGCGGTTGTGATGTAAATGCGGGATGTGGA
AAAAAGAACATCGAGAGCGTGAGGCGAAGCTAGCTCGCAAGACAAAGCGT
TACCCGAGCGACATGACGGATATCGAATGGGCCGCTGTGCAGCCGCTGCT
GCCACGCGCGGCCGTGCGTGGTCGGCGTCGGGAGTGCGACTTGAGGGAGG
TGGTCAATGCCTTGCGCTATCTGGTGCGGGCGGGCTGCGGCTGGCGCATG
CTGCCGCACGACTTTCCGCCGTGGCAGACCGTATATTGGTGGTTTCGTCG
GCTCATGCGCCGCTTCCTGTTCCGCACGCTGCATGACGTGGTGCTGATGC
TGGACCGGGAGCTGGCTGGGAGGCAGCCGTGCCCGAGTGGGGGCGTCATC
GACAGCCAGACAGTCAAAGCACCCTCGGCCGACAAGCGCGGCTACGACGC
CGCCAAGAAAGTCGTCGGGCGCAAGCGGCATATCGCGGTGGACACGGATG
GACGACTGCTGATGGTGAACCTGACACCGGCGGACATTGCCGATAGCACC
GGGGCGCTGGCGGTGCTGGAAGCGGTGAAGAAGCGCTGGCCGGGTATGGA
ACACCTGTTTGCAGACGGCGCCTACGACCGCACGGCGCTGATGGACAAGG
CATCGGCCCTCGACTTCGTGGTTGAGGTGGTGCGCCGGCACGAGCAGCAA
ACGGGCTTTGCCGTTCTGCCGCGCCGCTGGGTGGTCGAGCGCACCTTTGG
GTGGATGGTTCGCTGGCGCCGACTTGTACGCGACTACGAGCAGCGTGCGG
ACGTATCGGAAGCCATGATTCATATCGCGATGAGTGGCTTGTTACTGCGC
AGAATCGCTCATCCTTGAATTTCCAAACGGGCTC
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one el2POcEr)