Ralstonia solanacearum str. GMI1000

  1. RS05862ISRso1RS05862 ISRso1

RS05862
RSc0207
RSc0207
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSc0208
RSc0208
ID ISRso1
AC RS05862
LO RS05862
OR AL646052 from 231871 to 232754 on strand +
DE ISRso1
CL
PM
AN
SQ 884 nt
 
........10........20........30........40........50
| | | | |
GAGCCCGTTTGAAAATTCCCCGCCGTTGTGGTGTAAAGGCGGGATGTGGA
AAAAAGAACATCGAGAACGCGAGGCGAAGCTGGGTCGCAAGACCAAGCGG
TACCCAAGCGACCTGACGGATATCGAATGGGTCGCTGTGCAGCCGTTGCT
GCCCCGCGCCGCCGTGCGAGGTCGGCGTCGGGAGTGCGACTTGAGGGAGG
TGGTCAACGCCTTGCGCTATCTTGTGCGAGCGGGCTGCGGTTGGCGCATG
CTGCCTCACGACTTCCCGCCTTGGCAAACCGTGTATTGGTGGTTTCGTCG
GCTCATGCGTCGCTTCCTGTTCCGCACGCTGCACGACGTGGTGCTGATGT
TGGACCGGGAGTTGGCTGGGCGGCAGCCGTGCCCAAGTGCGGGCGTCATC
GACAGCCAGACAGTCAAAGCGCCCTCGGCCGACAAGCGTGGCTACGACGC
GGCCAAGAAAATCGTCGGGCGCAAGCGGCATATCGCGGTGGACACGGATG
GACGGCTGCTGATGGTGAACCTGACACCGGCGGACATTGCTGATAGCACG
GGTGCGCTGGCGGTGCTGGAAGCGGTGAAGAAGCGCTGGCCAGGCATAAA
ACACCTGTTCGCTGACGGTGCGTATGACCGCACAGCGCTGATGGACAAGG
CATCGACCCTCGACTTCGTGGTTGAGGTGGTGCGCCGGCACGAGCAGCAA
ACGGGCTTTGCCGTTCTGCCGCGCCGCTGGGTGGTCGAGCGCACCTTTGG
ATGGATGGTTCGCTGGCGTCGACTCGTACGCGACTACGAACAGCGGGCAG
ACGTATCGGAAGCCATGATTCATATCGCGATGAGCGGCTTGCTACTGCGC
AGAATCGCTCATCCTTGAATTTCCAAACGGGCTC
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one 6AYKNUZK)